Incidental Mutation 'R5465:Tet1'
ID433212
Institutional Source Beutler Lab
Gene Symbol Tet1
Ensembl Gene ENSMUSG00000047146
Gene Nametet methylcytosine dioxygenase 1
SynonymsBB001228, 2510010B09Rik, D10Ertd17e, Cxxc6
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62804570-62908996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62839777 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 840 (H840R)
Ref Sequence ENSEMBL: ENSMUSP00000133279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174189]
Predicted Effect probably benign
Transcript: ENSMUST00000050826
AA Change: H840R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: H840R

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.5e-11 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1931 1e-171 SMART
low complexity region 1944 1956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173081
Predicted Effect probably benign
Transcript: ENSMUST00000174189
AA Change: H840R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: H840R

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.7e-10 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1963 7.36e-170 SMART
low complexity region 1976 1988 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Tet1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Tet1 APN 10 62814497 missense probably damaging 1.00
IGL01079:Tet1 APN 10 62879473 missense probably damaging 0.99
IGL01109:Tet1 APN 10 62879774 missense probably benign
IGL01634:Tet1 APN 10 62878588 missense possibly damaging 0.94
IGL02003:Tet1 APN 10 62816400 missense possibly damaging 0.92
IGL02081:Tet1 APN 10 62813818 missense probably damaging 1.00
IGL02100:Tet1 APN 10 62812728 missense possibly damaging 0.92
IGL02228:Tet1 APN 10 62813734 missense probably damaging 0.99
IGL02524:Tet1 APN 10 62878646 missense probably damaging 1.00
IGL02539:Tet1 APN 10 62813019 missense possibly damaging 0.60
IGL02608:Tet1 APN 10 62879609 missense possibly damaging 0.82
IGL02608:Tet1 APN 10 62839087 missense probably damaging 1.00
IGL02702:Tet1 APN 10 62879752 missense possibly damaging 0.83
K7371:Tet1 UTSW 10 62879176 missense probably benign
R0166:Tet1 UTSW 10 62840279 missense probably benign 0.05
R0371:Tet1 UTSW 10 62878399 missense probably damaging 0.97
R0373:Tet1 UTSW 10 62878209 nonsense probably null
R0391:Tet1 UTSW 10 62814546 unclassified probably null
R0445:Tet1 UTSW 10 62879941 missense probably benign 0.08
R1016:Tet1 UTSW 10 62879950 missense probably benign
R1344:Tet1 UTSW 10 62814521 missense probably damaging 1.00
R1546:Tet1 UTSW 10 62812910 missense probably damaging 1.00
R1651:Tet1 UTSW 10 62879674 missense probably damaging 1.00
R1725:Tet1 UTSW 10 62814477 missense probably damaging 1.00
R1752:Tet1 UTSW 10 62812989 missense probably damaging 0.99
R1834:Tet1 UTSW 10 62813665 missense probably damaging 0.99
R1964:Tet1 UTSW 10 62812947 missense possibly damaging 0.86
R2239:Tet1 UTSW 10 62879734 missense probably benign 0.01
R2962:Tet1 UTSW 10 62814544 nonsense probably null
R3084:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3086:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3972:Tet1 UTSW 10 62813726 missense probably damaging 1.00
R4622:Tet1 UTSW 10 62819474 missense possibly damaging 0.92
R4674:Tet1 UTSW 10 62838848 missense probably damaging 0.97
R4687:Tet1 UTSW 10 62838791 missense probably benign 0.04
R4718:Tet1 UTSW 10 62813812 missense probably damaging 0.96
R4801:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4802:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4903:Tet1 UTSW 10 62822658 missense probably damaging 1.00
R5153:Tet1 UTSW 10 62878578 missense possibly damaging 0.85
R5193:Tet1 UTSW 10 62838247 missense probably benign 0.22
R5225:Tet1 UTSW 10 62838671 missense probably damaging 1.00
R5437:Tet1 UTSW 10 62814451 missense probably benign 0.01
R5535:Tet1 UTSW 10 62832907 missense probably damaging 1.00
R5586:Tet1 UTSW 10 62878294 missense probably damaging 1.00
R5763:Tet1 UTSW 10 62840068 missense probably damaging 1.00
R5788:Tet1 UTSW 10 62839958 missense possibly damaging 0.70
R5818:Tet1 UTSW 10 62816408 missense possibly damaging 0.71
R5860:Tet1 UTSW 10 62812620 unclassified probably null
R5975:Tet1 UTSW 10 62879773 missense probably benign 0.37
R6041:Tet1 UTSW 10 62813373 missense probably damaging 0.98
R6092:Tet1 UTSW 10 62813715 missense probably benign 0.10
R6132:Tet1 UTSW 10 62813300 missense probably damaging 0.99
R6157:Tet1 UTSW 10 62839970 missense probably damaging 0.98
R6520:Tet1 UTSW 10 62880013 start codon destroyed probably null 0.53
R7210:Tet1 UTSW 10 62814501 missense probably null 0.95
R7223:Tet1 UTSW 10 62813671 missense possibly damaging 0.95
R7255:Tet1 UTSW 10 62822636 missense probably benign 0.15
R7323:Tet1 UTSW 10 62880039 start gained probably benign
R7472:Tet1 UTSW 10 62813350 missense possibly damaging 0.84
R7507:Tet1 UTSW 10 62832892 critical splice donor site probably null
R7522:Tet1 UTSW 10 62818983 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAGCAGACTAGCCGTTTTCTG -3'
(R):5'- ATTGCTGACTGATCCCTCAAAC -3'

Sequencing Primer
(F):5'- CAGACTAGCCGTTTTCTGATGCG -3'
(R):5'- TGATCCCTCAAACTGCAAGGATG -3'
Posted On2016-10-06