Incidental Mutation 'R5466:Gm17430'
ID433260
Institutional Source Beutler Lab
Gene Symbol Gm17430
Ensembl Gene ENSMUSG00000091285
Gene Namepredicted gene, 17430
Synonyms
MMRRC Submission 043027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R5466 (G1)
Quality Score205
Status Not validated
Chromosome18
Chromosomal Location9726197-9726670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9726228 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000130323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040069] [ENSMUST00000171339]
Predicted Effect probably benign
Transcript: ENSMUST00000040069
SMART Domains Protein: ENSMUSP00000043220
Gene: ENSMUSG00000036103

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 112 157 N/A INTRINSIC
low complexity region 205 211 N/A INTRINSIC
coiled coil region 217 247 N/A INTRINSIC
low complexity region 268 280 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
Pfam:Collagen 441 499 1.4e-10 PFAM
Pfam:Collagen 482 548 9.6e-10 PFAM
Pfam:Collagen 530 591 3.8e-11 PFAM
CLECT 607 731 4.19e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171339
AA Change: V148A

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130323
Gene: ENSMUSG00000091285
AA Change: V148A

DomainStartEndE-ValueType
Pfam:Ribosomal_L24e 1 66 1e-26 PFAM
low complexity region 111 137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,711,389 A17E probably benign Het
Actc1 T C 2: 114,050,498 D82G probably damaging Het
Aox1 G C 1: 58,041,460 E23Q probably damaging Het
Arap3 A G 18: 37,996,736 V124A probably benign Het
Armc5 A G 7: 128,240,164 N218S probably damaging Het
Cacna2d1 T A 5: 16,246,714 V192E probably damaging Het
Col6a5 T A 9: 105,931,083 E922V unknown Het
Dennd4b G A 3: 90,268,500 probably null Het
Dnah12 A G 14: 26,771,050 D1256G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpy19l1 T C 9: 24,414,388 E707G probably damaging Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fgf11 T C 11: 69,799,441 I107V probably damaging Het
Fuca2 C T 10: 13,512,697 Q406* probably null Het
Gm10428 A G 11: 62,753,106 probably benign Het
Gm5930 A T 14: 44,337,557 N57K probably damaging Het
Gucy2c T A 6: 136,781,465 K48* probably null Het
Ip6k2 C T 9: 108,798,462 R109C probably damaging Het
Kif21b T A 1: 136,147,525 F159I probably damaging Het
Macf1 A T 4: 123,452,865 S1981T possibly damaging Het
Mga T A 2: 119,902,697 L9M probably damaging Het
Mov10l1 T C 15: 88,985,701 probably null Het
Msrb1 A T 17: 24,739,559 H39L possibly damaging Het
Olfr1222 A T 2: 89,125,133 F199L probably benign Het
Olfr449 A T 6: 42,838,093 T71S probably benign Het
Pcdha1 G A 18: 36,932,259 A659T possibly damaging Het
Pcm1 T A 8: 41,272,462 probably null Het
Rfpl4b C A 10: 38,821,398 C69F probably damaging Het
Tnn G A 1: 160,120,536 T869I possibly damaging Het
Trp53i11 C A 2: 93,199,383 L121I possibly damaging Het
Uimc1 A G 13: 55,075,848 S204P probably damaging Het
Usp43 A T 11: 67,913,883 N169K probably damaging Het
Vldlr A G 19: 27,239,843 probably null Het
Vmn2r115 A G 17: 23,360,056 I834M probably damaging Het
Zbtb21 A G 16: 97,950,498 S690P possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Gm17430
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0541:Gm17430 UTSW 18 9726267 missense probably damaging 0.99
R5037:Gm17430 UTSW 18 9726561 missense probably benign 0.02
R5840:Gm17430 UTSW 18 9726528 missense probably damaging 0.96
R6592:Gm17430 UTSW 18 9726514 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCAGACAGAAACTATTATGGGTCAG -3'
(R):5'- TCAAAGTCCATCGAGCCATC -3'

Sequencing Primer
(F):5'- TCAGAAGTGTGATGGCAACCCC -3'
(R):5'- GTCTCCTGCTGATATAATGGCCAAG -3'
Posted On2016-10-06