Incidental Mutation 'R5467:Skida1'
ID433268
Institutional Source Beutler Lab
Gene Symbol Skida1
Ensembl Gene ENSMUSG00000054074
Gene NameSKI/DACH domain containing 1
Synonyms
MMRRC Submission 043028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5467 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location18040676-18049051 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 18046112 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066885] [ENSMUST00000091420] [ENSMUST00000142856] [ENSMUST00000152908]
Predicted Effect unknown
Transcript: ENSMUST00000066885
AA Change: E656G
SMART Domains Protein: ENSMUSP00000068520
Gene: ENSMUSG00000054074
AA Change: E656G

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.1e-19 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 262 279 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
coiled coil region 315 337 N/A INTRINSIC
Pfam:DUF4584 383 820 9.7e-162 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000091420
AA Change: E743G
SMART Domains Protein: ENSMUSP00000088982
Gene: ENSMUSG00000054074
AA Change: E743G

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 97 7.7e-17 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
SCOP:d1gkub1 224 254 3e-3 SMART
SCOP:d1gkub1 296 321 6e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 369 384 N/A INTRINSIC
coiled coil region 402 424 N/A INTRINSIC
Pfam:DUF4584 471 907 7.7e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142856
SMART Domains Protein: ENSMUSP00000122112
Gene: ENSMUSG00000054074

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.4e-20 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152908
SMART Domains Protein: ENSMUSP00000114785
Gene: ENSMUSG00000054074

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 65 2.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173604
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,176,217 M525T possibly damaging Het
Arpc5l T C 2: 39,013,739 V80A possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Celsr3 A T 9: 108,828,637 D773V probably damaging Het
Clcn6 A T 4: 148,017,636 H330Q possibly damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
D430042O09Rik T C 7: 125,843,355 F812S possibly damaging Het
Dmbt1 C A 7: 131,040,993 S180R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dusp27 C A 1: 166,112,030 probably null Het
Elovl7 T C 13: 108,279,622 V182A probably benign Het
Eml3 G A 19: 8,937,582 W601* probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fras1 A T 5: 96,780,053 Y3775F probably benign Het
Gm884 G T 11: 103,603,265 C655* probably null Het
Gns T C 10: 121,391,446 W454R probably benign Het
Kcnh2 A T 5: 24,326,767 L40* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mgl2 T A 11: 70,135,052 I31N possibly damaging Het
Muc6 T C 7: 141,636,535 T2677A possibly damaging Het
Ndst1 A G 18: 60,692,021 S742P probably benign Het
Olfr108 G T 17: 37,446,082 C187F probably damaging Het
Olfr1428 A C 19: 12,108,659 S70A probably benign Het
Olfr1466 A T 19: 13,342,157 Y133F probably damaging Het
Olfr935 T C 9: 38,994,904 Y177C probably benign Het
Olfr981 G T 9: 40,022,437 V15L probably benign Het
Pcdhb22 A G 18: 37,520,135 D552G probably benign Het
Pikfyve T A 1: 65,252,495 V1291E probably damaging Het
Ppp4r3a T C 12: 101,043,470 E636G probably damaging Het
Prl5a1 A T 13: 28,150,011 I166L possibly damaging Het
Rb1 T C 14: 73,211,620 D690G possibly damaging Het
Sh3tc2 A G 18: 61,990,688 H840R possibly damaging Het
Slc31a2 A G 4: 62,292,687 H19R probably damaging Het
Tnks2 A T 19: 36,881,776 R314W probably damaging Het
Trak1 A G 9: 121,446,798 D189G probably damaging Het
Trav13n-4 T A 14: 53,363,846 V24E probably damaging Het
Uhrf1bp1l G T 10: 89,805,099 G711W probably damaging Het
Ylpm1 T C 12: 84,996,859 Y124H unknown Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Skida1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Skida1 APN 2 18046005 unclassified probably benign
IGL03220:Skida1 APN 2 18048161 missense probably damaging 1.00
R0328:Skida1 UTSW 2 18047186 unclassified probably benign
R0732:Skida1 UTSW 2 18046157 unclassified probably benign
R1239:Skida1 UTSW 2 18047317 unclassified probably benign
R1346:Skida1 UTSW 2 18048279 missense possibly damaging 0.92
R1597:Skida1 UTSW 2 18046332 unclassified probably benign
R1867:Skida1 UTSW 2 18046344 unclassified probably benign
R3797:Skida1 UTSW 2 18045897 nonsense probably null
R4521:Skida1 UTSW 2 18045872 unclassified probably benign
R5270:Skida1 UTSW 2 18047649 missense probably benign 0.03
R5890:Skida1 UTSW 2 18046003 unclassified probably benign
R7181:Skida1 UTSW 2 18046791 missense unknown
R7398:Skida1 UTSW 2 18046272 missense unknown
Predicted Primers PCR Primer
(F):5'- CGAGGGCTTCTAGCTGATTTC -3'
(R):5'- ACAGGTGACAAGACATTGCC -3'

Sequencing Primer
(F):5'- AGGGCTTCTAGCTGATTTCAAATTTG -3'
(R):5'- CAGGTGACAAGACATTGCCATTTC -3'
Posted On2016-10-06