Incidental Mutation 'R5467:Prl5a1'
ID433293
Institutional Source Beutler Lab
Gene Symbol Prl5a1
Ensembl Gene ENSMUSG00000017064
Gene Nameprolactin family 5, subfamily a, member 1
SynonymsD13Wsu14e, 1600013P04Rik, Prlpl, PLP-L
MMRRC Submission 043028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5467 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location28142484-28151611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28150011 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 166 (I166L)
Ref Sequence ENSEMBL: ENSMUSP00000017208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017208]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017208
AA Change: I166L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017208
Gene: ENSMUSG00000017064
AA Change: I166L

DomainStartEndE-ValueType
Pfam:Hormone_1 17 230 4.8e-50 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,176,217 M525T possibly damaging Het
Arpc5l T C 2: 39,013,739 V80A possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Celsr3 A T 9: 108,828,637 D773V probably damaging Het
Clcn6 A T 4: 148,017,636 H330Q possibly damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
D430042O09Rik T C 7: 125,843,355 F812S possibly damaging Het
Dmbt1 C A 7: 131,040,993 S180R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dusp27 C A 1: 166,112,030 probably null Het
Elovl7 T C 13: 108,279,622 V182A probably benign Het
Eml3 G A 19: 8,937,582 W601* probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fras1 A T 5: 96,780,053 Y3775F probably benign Het
Gm884 G T 11: 103,603,265 C655* probably null Het
Gns T C 10: 121,391,446 W454R probably benign Het
Kcnh2 A T 5: 24,326,767 L40* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mgl2 T A 11: 70,135,052 I31N possibly damaging Het
Muc6 T C 7: 141,636,535 T2677A possibly damaging Het
Ndst1 A G 18: 60,692,021 S742P probably benign Het
Olfr108 G T 17: 37,446,082 C187F probably damaging Het
Olfr1428 A C 19: 12,108,659 S70A probably benign Het
Olfr1466 A T 19: 13,342,157 Y133F probably damaging Het
Olfr935 T C 9: 38,994,904 Y177C probably benign Het
Olfr981 G T 9: 40,022,437 V15L probably benign Het
Pcdhb22 A G 18: 37,520,135 D552G probably benign Het
Pikfyve T A 1: 65,252,495 V1291E probably damaging Het
Ppp4r3a T C 12: 101,043,470 E636G probably damaging Het
Rb1 T C 14: 73,211,620 D690G possibly damaging Het
Sh3tc2 A G 18: 61,990,688 H840R possibly damaging Het
Skida1 T C 2: 18,046,112 probably benign Het
Slc31a2 A G 4: 62,292,687 H19R probably damaging Het
Tnks2 A T 19: 36,881,776 R314W probably damaging Het
Trak1 A G 9: 121,446,798 D189G probably damaging Het
Trav13n-4 T A 14: 53,363,846 V24E probably damaging Het
Uhrf1bp1l G T 10: 89,805,099 G711W probably damaging Het
Ylpm1 T C 12: 84,996,859 Y124H unknown Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Prl5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Prl5a1 APN 13 28145439 missense possibly damaging 0.77
IGL01820:Prl5a1 APN 13 28148700 missense probably benign 0.34
IGL02682:Prl5a1 APN 13 28145420 missense probably benign 0.32
R0266:Prl5a1 UTSW 13 28149987 missense possibly damaging 0.77
R1022:Prl5a1 UTSW 13 28149897 missense probably damaging 0.97
R1024:Prl5a1 UTSW 13 28149897 missense probably damaging 0.97
R2098:Prl5a1 UTSW 13 28145505 missense probably damaging 1.00
R6002:Prl5a1 UTSW 13 28145482 missense probably benign 0.00
R6026:Prl5a1 UTSW 13 28151264 missense probably benign 0.43
R6242:Prl5a1 UTSW 13 28142555 nonsense probably null
R6616:Prl5a1 UTSW 13 28149856 missense probably benign 0.00
R6733:Prl5a1 UTSW 13 28149936 missense possibly damaging 0.81
R6979:Prl5a1 UTSW 13 28151206 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GGTGCTTCTGAATGTGACAATTAG -3'
(R):5'- TGGCAGGCAGAGAATCAGTC -3'

Sequencing Primer
(F):5'- CAATTAGAATGCTGGCTGCC -3'
(R):5'- CAGAGAATCAGTCCCAGGTTTG -3'
Posted On2016-10-06