Incidental Mutation 'R5467:Olfr108'
ID433300
Institutional Source Beutler Lab
Gene Symbol Olfr108
Ensembl Gene ENSMUSG00000059687
Gene Nameolfactory receptor 108
SynonymsMOR156-5, GA_x6K02T2PSCP-1893605-1894534
MMRRC Submission 043028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5467 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37445480-37446517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37446082 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 187 (C187F)
Ref Sequence ENSEMBL: ENSMUSP00000151360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078207] [ENSMUST00000207414] [ENSMUST00000218675]
Predicted Effect probably damaging
Transcript: ENSMUST00000078207
AA Change: C176F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077337
Gene: ENSMUSG00000059687
AA Change: C176F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 33 315 8.8e-9 PFAM
Pfam:7tm_4 39 316 9.5e-54 PFAM
Pfam:7tm_1 49 298 1.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207414
AA Change: C187F
Predicted Effect probably damaging
Transcript: ENSMUST00000218675
AA Change: C187F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,176,217 M525T possibly damaging Het
Arpc5l T C 2: 39,013,739 V80A possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Celsr3 A T 9: 108,828,637 D773V probably damaging Het
Clcn6 A T 4: 148,017,636 H330Q possibly damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
D430042O09Rik T C 7: 125,843,355 F812S possibly damaging Het
Dmbt1 C A 7: 131,040,993 S180R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dusp27 C A 1: 166,112,030 probably null Het
Elovl7 T C 13: 108,279,622 V182A probably benign Het
Eml3 G A 19: 8,937,582 W601* probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fras1 A T 5: 96,780,053 Y3775F probably benign Het
Gm884 G T 11: 103,603,265 C655* probably null Het
Gns T C 10: 121,391,446 W454R probably benign Het
Kcnh2 A T 5: 24,326,767 L40* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mgl2 T A 11: 70,135,052 I31N possibly damaging Het
Muc6 T C 7: 141,636,535 T2677A possibly damaging Het
Ndst1 A G 18: 60,692,021 S742P probably benign Het
Olfr1428 A C 19: 12,108,659 S70A probably benign Het
Olfr1466 A T 19: 13,342,157 Y133F probably damaging Het
Olfr935 T C 9: 38,994,904 Y177C probably benign Het
Olfr981 G T 9: 40,022,437 V15L probably benign Het
Pcdhb22 A G 18: 37,520,135 D552G probably benign Het
Pikfyve T A 1: 65,252,495 V1291E probably damaging Het
Ppp4r3a T C 12: 101,043,470 E636G probably damaging Het
Prl5a1 A T 13: 28,150,011 I166L possibly damaging Het
Rb1 T C 14: 73,211,620 D690G possibly damaging Het
Sh3tc2 A G 18: 61,990,688 H840R possibly damaging Het
Skida1 T C 2: 18,046,112 probably benign Het
Slc31a2 A G 4: 62,292,687 H19R probably damaging Het
Tnks2 A T 19: 36,881,776 R314W probably damaging Het
Trak1 A G 9: 121,446,798 D189G probably damaging Het
Trav13n-4 T A 14: 53,363,846 V24E probably damaging Het
Uhrf1bp1l G T 10: 89,805,099 G711W probably damaging Het
Ylpm1 T C 12: 84,996,859 Y124H unknown Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Olfr108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Olfr108 APN 17 37445714 missense probably benign 0.44
IGL01469:Olfr108 APN 17 37445535 missense probably benign 0.00
IGL02291:Olfr108 APN 17 37446285 missense possibly damaging 0.62
IGL02892:Olfr108 APN 17 37446034 missense probably damaging 1.00
IGL03390:Olfr108 APN 17 37446364 missense probably benign 0.02
R0115:Olfr108 UTSW 17 37445779 missense probably benign 0.00
R0395:Olfr108 UTSW 17 37445866 missense probably damaging 1.00
R0427:Olfr108 UTSW 17 37445702 missense probably damaging 0.99
R0557:Olfr108 UTSW 17 37445821 missense probably damaging 1.00
R1709:Olfr108 UTSW 17 37446200 nonsense probably null
R3076:Olfr108 UTSW 17 37445484 start gained probably benign
R5642:Olfr108 UTSW 17 37445772 missense probably damaging 1.00
R5916:Olfr108 UTSW 17 37445679 missense probably benign 0.16
R7451:Olfr108 UTSW 17 37446305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGCTGCTATCTGCCAC -3'
(R):5'- TAGGTAGCAAAGACTGTGCTG -3'

Sequencing Primer
(F):5'- GCTATCTGCCACCCACTC -3'
(R):5'- AACTGCATGTGGTCAGGGC -3'
Posted On2016-10-06