Incidental Mutation 'R5467:Ndst1'
ID433302
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonymsglucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik
MMRRC Submission 043028-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5467 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location60685978-60713389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60692021 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 742 (S742P)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
Predicted Effect probably benign
Transcript: ENSMUST00000169273
AA Change: S742P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: S742P

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,176,217 M525T possibly damaging Het
Arpc5l T C 2: 39,013,739 V80A possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Celsr3 A T 9: 108,828,637 D773V probably damaging Het
Clcn6 A T 4: 148,017,636 H330Q possibly damaging Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
D430042O09Rik T C 7: 125,843,355 F812S possibly damaging Het
Dmbt1 C A 7: 131,040,993 S180R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dusp27 C A 1: 166,112,030 probably null Het
Elovl7 T C 13: 108,279,622 V182A probably benign Het
Eml3 G A 19: 8,937,582 W601* probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fras1 A T 5: 96,780,053 Y3775F probably benign Het
Gm884 G T 11: 103,603,265 C655* probably null Het
Gns T C 10: 121,391,446 W454R probably benign Het
Kcnh2 A T 5: 24,326,767 L40* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mgl2 T A 11: 70,135,052 I31N possibly damaging Het
Muc6 T C 7: 141,636,535 T2677A possibly damaging Het
Olfr108 G T 17: 37,446,082 C187F probably damaging Het
Olfr1428 A C 19: 12,108,659 S70A probably benign Het
Olfr1466 A T 19: 13,342,157 Y133F probably damaging Het
Olfr935 T C 9: 38,994,904 Y177C probably benign Het
Olfr981 G T 9: 40,022,437 V15L probably benign Het
Pcdhb22 A G 18: 37,520,135 D552G probably benign Het
Pikfyve T A 1: 65,252,495 V1291E probably damaging Het
Ppp4r3a T C 12: 101,043,470 E636G probably damaging Het
Prl5a1 A T 13: 28,150,011 I166L possibly damaging Het
Rb1 T C 14: 73,211,620 D690G possibly damaging Het
Sh3tc2 A G 18: 61,990,688 H840R possibly damaging Het
Skida1 T C 2: 18,046,112 probably benign Het
Slc31a2 A G 4: 62,292,687 H19R probably damaging Het
Tnks2 A T 19: 36,881,776 R314W probably damaging Het
Trak1 A G 9: 121,446,798 D189G probably damaging Het
Trav13n-4 T A 14: 53,363,846 V24E probably damaging Het
Uhrf1bp1l G T 10: 89,805,099 G711W probably damaging Het
Ylpm1 T C 12: 84,996,859 Y124H unknown Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60707956 missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60700445 missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60713126 missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60699546 missense probably benign 0.05
IGL03200:Ndst1 APN 18 60699539 missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60700359 splice site probably benign
R0899:Ndst1 UTSW 18 60707882 missense probably benign 0.00
R1104:Ndst1 UTSW 18 60697146 missense probably damaging 0.98
R1371:Ndst1 UTSW 18 60707647 missense possibly damaging 0.90
R1456:Ndst1 UTSW 18 60713205 missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60697170 missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60698504 missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60695508 missense probably damaging 1.00
R1718:Ndst1 UTSW 18 60707803 missense probably damaging 0.99
R1772:Ndst1 UTSW 18 60702837 missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60712721 critical splice donor site probably null
R2079:Ndst1 UTSW 18 60695509 missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60691253 missense probably benign 0.01
R2127:Ndst1 UTSW 18 60691208 missense probably benign 0.00
R2875:Ndst1 UTSW 18 60690047 missense probably damaging 1.00
R3798:Ndst1 UTSW 18 60713166 missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3951:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3952:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R4868:Ndst1 UTSW 18 60695476 missense probably benign 0.07
R4898:Ndst1 UTSW 18 60691987 missense probably benign 0.12
R4988:Ndst1 UTSW 18 60702933 missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60705132 missense probably benign 0.03
R5337:Ndst1 UTSW 18 60690007 missense probably damaging 1.00
R5830:Ndst1 UTSW 18 60703838 missense probably damaging 1.00
R5968:Ndst1 UTSW 18 60713076 missense probably benign
R6241:Ndst1 UTSW 18 60703829 missense probably damaging 0.99
R6422:Ndst1 UTSW 18 60702953 missense probably benign 0.44
R7099:Ndst1 UTSW 18 60695500 missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60697184 missense probably damaging 1.00
V8831:Ndst1 UTSW 18 60702927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGATCTAACCCTGCCAAC -3'
(R):5'- CCTGAGGCTAAAGCAGTGAG -3'

Sequencing Primer
(F):5'- TCCAATCAGGCTCAGGCTCAG -3'
(R):5'- CTAAAGCAGTGAGAGGGAGAAGC -3'
Posted On2016-10-06