Incidental Mutation 'R5468:1700008O03Rik'
List |< first << previous [record 43 of 33389] next >> last >|
ID433338
Institutional Source Beutler Lab
Gene Symbol 1700008O03Rik
Ensembl Gene ENSMUSG00000008028
Gene NameRIKEN cDNA 1700008O03 gene
Synonyms
MMRRC Submission 043029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R5468 (G1)
Quality Score178
Status Not validated
Chromosome7
Chromosomal Location44360043-44385820 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44360235 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 181 (R181Q)
Ref Sequence ENSEMBL: ENSMUSP00000103566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107933] [ENSMUST00000107934] [ENSMUST00000107935] [ENSMUST00000107938] [ENSMUST00000150886]
Predicted Effect probably damaging
Transcript: ENSMUST00000107933
AA Change: R181Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103566
Gene: ENSMUSG00000008028
AA Change: R181Q

DomainStartEndE-ValueType
Pfam:DUF4732 23 179 4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107934
SMART Domains Protein: ENSMUSP00000103567
Gene: ENSMUSG00000038738

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
PDZ 663 752 2.12e-13 SMART
Blast:PDZ 795 830 5e-11 BLAST
low complexity region 920 941 N/A INTRINSIC
low complexity region 955 982 N/A INTRINSIC
low complexity region 993 1023 N/A INTRINSIC
low complexity region 1051 1080 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
low complexity region 1179 1220 N/A INTRINSIC
low complexity region 1256 1275 N/A INTRINSIC
low complexity region 1298 1323 N/A INTRINSIC
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1369 1404 N/A INTRINSIC
low complexity region 1450 1466 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
low complexity region 1539 1555 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
low complexity region 1580 1614 N/A INTRINSIC
low complexity region 1633 1667 N/A INTRINSIC
low complexity region 1685 1720 N/A INTRINSIC
low complexity region 1735 1746 N/A INTRINSIC
low complexity region 1776 1787 N/A INTRINSIC
low complexity region 1806 1823 N/A INTRINSIC
low complexity region 1834 1852 N/A INTRINSIC
low complexity region 1893 1907 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
low complexity region 1942 1976 N/A INTRINSIC
low complexity region 1988 2004 N/A INTRINSIC
low complexity region 2009 2029 N/A INTRINSIC
low complexity region 2059 2083 N/A INTRINSIC
SAM 2092 2158 1.35e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107935
SMART Domains Protein: ENSMUSP00000103568
Gene: ENSMUSG00000038738

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 796 831 1e-10 BLAST
low complexity region 921 942 N/A INTRINSIC
low complexity region 956 983 N/A INTRINSIC
low complexity region 994 1024 N/A INTRINSIC
low complexity region 1052 1081 N/A INTRINSIC
low complexity region 1124 1139 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
low complexity region 1180 1221 N/A INTRINSIC
low complexity region 1257 1276 N/A INTRINSIC
low complexity region 1299 1324 N/A INTRINSIC
low complexity region 1349 1360 N/A INTRINSIC
low complexity region 1370 1405 N/A INTRINSIC
low complexity region 1451 1467 N/A INTRINSIC
low complexity region 1513 1533 N/A INTRINSIC
low complexity region 1540 1556 N/A INTRINSIC
low complexity region 1558 1571 N/A INTRINSIC
low complexity region 1581 1615 N/A INTRINSIC
low complexity region 1634 1668 N/A INTRINSIC
low complexity region 1686 1721 N/A INTRINSIC
low complexity region 1736 1747 N/A INTRINSIC
low complexity region 1777 1788 N/A INTRINSIC
low complexity region 1807 1824 N/A INTRINSIC
low complexity region 1835 1853 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 1926 1937 N/A INTRINSIC
low complexity region 1943 1977 N/A INTRINSIC
low complexity region 1989 2005 N/A INTRINSIC
low complexity region 2010 2030 N/A INTRINSIC
low complexity region 2060 2084 N/A INTRINSIC
SAM 2093 2159 1.35e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107938
SMART Domains Protein: ENSMUSP00000103571
Gene: ENSMUSG00000038738

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Pfam:FERM_f0 73 156 6.6e-17 PFAM
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 804 839 5e-11 BLAST
low complexity region 929 950 N/A INTRINSIC
low complexity region 964 991 N/A INTRINSIC
low complexity region 1002 1032 N/A INTRINSIC
low complexity region 1060 1089 N/A INTRINSIC
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1188 1229 N/A INTRINSIC
low complexity region 1265 1284 N/A INTRINSIC
low complexity region 1307 1332 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1378 1413 N/A INTRINSIC
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 1521 1541 N/A INTRINSIC
low complexity region 1548 1564 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
low complexity region 1589 1623 N/A INTRINSIC
low complexity region 1642 1676 N/A INTRINSIC
low complexity region 1694 1729 N/A INTRINSIC
low complexity region 1744 1755 N/A INTRINSIC
low complexity region 1785 1796 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1843 1861 N/A INTRINSIC
low complexity region 1902 1916 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
low complexity region 1951 1985 N/A INTRINSIC
low complexity region 1997 2013 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
low complexity region 2068 2092 N/A INTRINSIC
SAM 2101 2167 1.35e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150034
Predicted Effect probably benign
Transcript: ENSMUST00000150886
SMART Domains Protein: ENSMUSP00000123280
Gene: ENSMUSG00000008028

DomainStartEndE-ValueType
low complexity region 111 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205409
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,294,062 L1975Q probably damaging Het
Acp2 T A 2: 91,206,098 I180N probably benign Het
Adam12 T C 7: 133,975,473 D221G probably damaging Het
Adamts4 A G 1: 171,252,609 T244A probably benign Het
Adrb2 A T 18: 62,179,625 I43N probably damaging Het
Anxa1 A T 19: 20,378,483 Y207N probably damaging Het
Apba2 T C 7: 64,745,762 L662P probably damaging Het
Arhgap18 T A 10: 26,912,671 I593K probably damaging Het
Arsj T C 3: 126,438,388 V261A possibly damaging Het
Atp7b A T 8: 22,059,970 probably null Het
C2cd2 C T 16: 97,868,591 probably null Het
C530008M17Rik A T 5: 76,840,763 probably benign Het
Cenpf A T 1: 189,652,371 S2571T probably damaging Het
Cep162 A C 9: 87,227,237 L438V probably benign Het
Cfap74 A T 4: 155,426,041 N361I probably benign Het
Cntn5 A G 9: 9,743,628 I548T probably damaging Het
Dglucy A G 12: 100,850,335 N382S probably benign Het
Dnah10 C A 5: 124,830,493 N4306K probably damaging Het
Fam181a A T 12: 103,316,678 M281L probably benign Het
Fam186b A G 15: 99,278,870 I713T possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fry A T 5: 150,399,588 Y1068F probably benign Het
Fubp3 A G 2: 31,603,235 I231V probably benign Het
Gbf1 A G 19: 46,284,296 D1681G possibly damaging Het
Gm10999 G A 8: 129,131,649 P5S probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Impg1 T C 9: 80,465,265 I9V probably benign Het
Lama4 A G 10: 39,072,682 probably null Het
Lamc1 A G 1: 153,233,564 S1161P probably damaging Het
Lipm T A 19: 34,109,554 probably null Het
Lrrc7 G T 3: 158,318,436 N107K probably damaging Het
Lypd8 T C 11: 58,386,760 S123P probably damaging Het
Man2a2 T C 7: 80,352,981 D1084G probably damaging Het
Man2b2 A G 5: 36,807,175 S1000P probably benign Het
Ms4a7 C T 19: 11,322,414 C71Y probably benign Het
Mtus1 A G 8: 41,084,578 S34P probably benign Het
Myo3b A G 2: 70,234,441 N406S probably benign Het
Nbr1 A T 11: 101,572,464 M586L probably benign Het
Nfatc1 C T 18: 80,649,855 R677H probably benign Het
Nlrc3 A C 16: 3,964,035 S503R probably damaging Het
Nlrp9c A T 7: 26,365,000 F968I probably benign Het
Olfr340 A T 2: 36,453,443 N286I probably damaging Het
Olfr881 G A 9: 37,993,011 C168Y probably damaging Het
Olfr951 A G 9: 39,393,961 N57D probably benign Het
Onecut1 A T 9: 74,863,332 T346S probably damaging Het
Pclo A T 5: 14,680,952 K3156M unknown Het
Pigo C T 4: 43,024,562 probably null Het
Plcb4 T C 2: 135,967,152 F580S probably damaging Het
Plekhm2 G T 4: 141,628,100 P879H probably damaging Het
Ppm1e T A 11: 87,230,890 Y747F probably benign Het
Ppwd1 A G 13: 104,225,444 F69L possibly damaging Het
Prss27 C A 17: 24,038,313 Q3K possibly damaging Het
Prss29 T A 17: 25,321,046 N139K possibly damaging Het
Qrich2 T A 11: 116,448,365 T1777S probably damaging Het
Rbp3 A T 14: 33,956,627 H844L possibly damaging Het
Rubcnl G A 14: 75,032,031 C43Y possibly damaging Het
Sec14l5 A G 16: 5,167,140 probably null Het
Sepsecs A T 5: 52,644,014 N435K probably damaging Het
Sfrp1 A G 8: 23,446,210 K223E probably benign Het
Sh3tc2 G A 18: 61,973,431 probably null Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Tmprss7 A G 16: 45,656,448 F817S probably damaging Het
Tril T C 6: 53,819,647 N197D probably damaging Het
Tspan18 T C 2: 93,209,862 T183A probably benign Het
Uroc1 A T 6: 90,338,604 M156L probably benign Het
Wnt16 T C 6: 22,291,161 V196A probably benign Het
Xpnpep1 A G 19: 52,995,519 Y592H probably benign Het
Zfp553 T C 7: 127,237,030 S586P probably benign Het
Zfp619 C T 7: 39,535,728 A394V unknown Het
Zfp985 A G 4: 147,583,245 Y190C probably benign Het
Zmynd10 T A 9: 107,550,337 D309E probably benign Het
Zmynd15 T C 11: 70,461,820 L73P probably damaging Het
Other mutations in 1700008O03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:1700008O03Rik APN 7 44360186 makesense probably null
IGL02933:1700008O03Rik APN 7 44363012 missense possibly damaging 0.90
R2372:1700008O03Rik UTSW 7 44360280 missense probably damaging 1.00
R5540:1700008O03Rik UTSW 7 44362947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTTGCCGAGAGAAATGGC -3'
(R):5'- TGAACCCAAAGACGTCTCTGG -3'

Sequencing Primer
(F):5'- CCGAGAGAAATGGCTTTTGTATCAG -3'
(R):5'- AAAGACGTCTCTGGGCCTTCAC -3'
Posted On2016-10-06