Incidental Mutation 'R5468:Impg1'
ID433352
Institutional Source Beutler Lab
Gene Symbol Impg1
Ensembl Gene ENSMUSG00000032343
Gene Nameinterphotoreceptor matrix proteoglycan 1
SynonymsIMP150, SPACR, A930015H12Rik
MMRRC Submission 043029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5468 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location80313330-80465481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80465265 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 9 (I9V)
Ref Sequence ENSEMBL: ENSMUSP00000139151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085289] [ENSMUST00000113250] [ENSMUST00000185068]
Predicted Effect probably benign
Transcript: ENSMUST00000085289
AA Change: I9V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082395
Gene: ENSMUSG00000032343
AA Change: I9V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 158 273 8.68e-1 SMART
low complexity region 353 374 N/A INTRINSIC
SEA 494 616 1.37e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113250
AA Change: I9V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108876
Gene: ENSMUSG00000032343
AA Change: I9V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 235 350 8.68e-1 SMART
low complexity region 430 451 N/A INTRINSIC
SEA 571 693 1.37e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185068
AA Change: I9V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139151
Gene: ENSMUSG00000032343
AA Change: I9V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:SEA 157 216 1.2e-13 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a major component of the retinal interphotoreceptor matrix. The encoded protein is a proteoglycan that is thought to play a role in maintaining viability of photoreceptor cells and in adhesion of the neural retina to the retinal pigment epithelium. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik C T 7: 44,360,235 R181Q probably damaging Het
Abca13 T A 11: 9,294,062 L1975Q probably damaging Het
Acp2 T A 2: 91,206,098 I180N probably benign Het
Adam12 T C 7: 133,975,473 D221G probably damaging Het
Adamts4 A G 1: 171,252,609 T244A probably benign Het
Adrb2 A T 18: 62,179,625 I43N probably damaging Het
Anxa1 A T 19: 20,378,483 Y207N probably damaging Het
Apba2 T C 7: 64,745,762 L662P probably damaging Het
Arhgap18 T A 10: 26,912,671 I593K probably damaging Het
Arsj T C 3: 126,438,388 V261A possibly damaging Het
Atp7b A T 8: 22,059,970 probably null Het
C2cd2 C T 16: 97,868,591 probably null Het
C530008M17Rik A T 5: 76,840,763 probably benign Het
Cenpf A T 1: 189,652,371 S2571T probably damaging Het
Cep162 A C 9: 87,227,237 L438V probably benign Het
Cfap74 A T 4: 155,426,041 N361I probably benign Het
Cntn5 A G 9: 9,743,628 I548T probably damaging Het
Dglucy A G 12: 100,850,335 N382S probably benign Het
Dnah10 C A 5: 124,830,493 N4306K probably damaging Het
Fam181a A T 12: 103,316,678 M281L probably benign Het
Fam186b A G 15: 99,278,870 I713T possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fry A T 5: 150,399,588 Y1068F probably benign Het
Fubp3 A G 2: 31,603,235 I231V probably benign Het
Gbf1 A G 19: 46,284,296 D1681G possibly damaging Het
Gm10999 G A 8: 129,131,649 P5S probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Lama4 A G 10: 39,072,682 probably null Het
Lamc1 A G 1: 153,233,564 S1161P probably damaging Het
Lipm T A 19: 34,109,554 probably null Het
Lrrc7 G T 3: 158,318,436 N107K probably damaging Het
Lypd8 T C 11: 58,386,760 S123P probably damaging Het
Man2a2 T C 7: 80,352,981 D1084G probably damaging Het
Man2b2 A G 5: 36,807,175 S1000P probably benign Het
Ms4a7 C T 19: 11,322,414 C71Y probably benign Het
Mtus1 A G 8: 41,084,578 S34P probably benign Het
Myo3b A G 2: 70,234,441 N406S probably benign Het
Nbr1 A T 11: 101,572,464 M586L probably benign Het
Nfatc1 C T 18: 80,649,855 R677H probably benign Het
Nlrc3 A C 16: 3,964,035 S503R probably damaging Het
Nlrp9c A T 7: 26,365,000 F968I probably benign Het
Olfr340 A T 2: 36,453,443 N286I probably damaging Het
Olfr881 G A 9: 37,993,011 C168Y probably damaging Het
Olfr951 A G 9: 39,393,961 N57D probably benign Het
Onecut1 A T 9: 74,863,332 T346S probably damaging Het
Pclo A T 5: 14,680,952 K3156M unknown Het
Pigo C T 4: 43,024,562 probably null Het
Plcb4 T C 2: 135,967,152 F580S probably damaging Het
Plekhm2 G T 4: 141,628,100 P879H probably damaging Het
Ppm1e T A 11: 87,230,890 Y747F probably benign Het
Ppwd1 A G 13: 104,225,444 F69L possibly damaging Het
Prss27 C A 17: 24,038,313 Q3K possibly damaging Het
Prss29 T A 17: 25,321,046 N139K possibly damaging Het
Qrich2 T A 11: 116,448,365 T1777S probably damaging Het
Rbp3 A T 14: 33,956,627 H844L possibly damaging Het
Rubcnl G A 14: 75,032,031 C43Y possibly damaging Het
Sec14l5 A G 16: 5,167,140 probably null Het
Sepsecs A T 5: 52,644,014 N435K probably damaging Het
Sfrp1 A G 8: 23,446,210 K223E probably benign Het
Sh3tc2 G A 18: 61,973,431 probably null Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Tmprss7 A G 16: 45,656,448 F817S probably damaging Het
Tril T C 6: 53,819,647 N197D probably damaging Het
Tspan18 T C 2: 93,209,862 T183A probably benign Het
Uroc1 A T 6: 90,338,604 M156L probably benign Het
Wnt16 T C 6: 22,291,161 V196A probably benign Het
Xpnpep1 A G 19: 52,995,519 Y592H probably benign Het
Zfp553 T C 7: 127,237,030 S586P probably benign Het
Zfp619 C T 7: 39,535,728 A394V unknown Het
Zfp985 A G 4: 147,583,245 Y190C probably benign Het
Zmynd10 T A 9: 107,550,337 D309E probably benign Het
Zmynd15 T C 11: 70,461,820 L73P probably damaging Het
Other mutations in Impg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Impg1 APN 9 80322829 missense probably benign 0.02
IGL01733:Impg1 APN 9 80341924 missense probably damaging 0.99
IGL02333:Impg1 APN 9 80440755 missense possibly damaging 0.74
IGL03097:Impg1 UTSW 9 80379952 missense possibly damaging 0.48
R0021:Impg1 UTSW 9 80435426 missense probably damaging 1.00
R0029:Impg1 UTSW 9 80398371 missense probably damaging 1.00
R0029:Impg1 UTSW 9 80398371 missense probably damaging 1.00
R0108:Impg1 UTSW 9 80322848 missense possibly damaging 0.63
R0201:Impg1 UTSW 9 80345561 missense probably damaging 1.00
R0271:Impg1 UTSW 9 80386879 splice site probably benign
R0316:Impg1 UTSW 9 80342065 missense probably damaging 1.00
R0492:Impg1 UTSW 9 80345308 missense possibly damaging 0.74
R0633:Impg1 UTSW 9 80394155 missense possibly damaging 0.72
R0705:Impg1 UTSW 9 80379979 missense probably damaging 1.00
R0962:Impg1 UTSW 9 80381741 missense probably benign 0.23
R1264:Impg1 UTSW 9 80314393 missense probably benign 0.31
R1707:Impg1 UTSW 9 80378517 splice site probably null
R2017:Impg1 UTSW 9 80440667 missense probably damaging 1.00
R3904:Impg1 UTSW 9 80345585 missense possibly damaging 0.76
R3960:Impg1 UTSW 9 80440864 missense probably benign 0.00
R4231:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4233:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4235:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4236:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4490:Impg1 UTSW 9 80394059 missense probably damaging 1.00
R4592:Impg1 UTSW 9 80440854 missense probably benign 0.05
R4701:Impg1 UTSW 9 80314400 missense probably benign 0.07
R4785:Impg1 UTSW 9 80398450 missense probably benign 0.01
R4796:Impg1 UTSW 9 80394095 missense probably damaging 0.99
R4923:Impg1 UTSW 9 80345078 nonsense probably null
R4923:Impg1 UTSW 9 80345545 missense probably damaging 0.98
R5596:Impg1 UTSW 9 80345218 missense probably benign 0.24
R6001:Impg1 UTSW 9 80316172 missense probably benign 0.12
R6156:Impg1 UTSW 9 80322824 missense probably damaging 1.00
R6315:Impg1 UTSW 9 80394074 missense probably benign 0.21
R6419:Impg1 UTSW 9 80380018 missense probably benign 0.38
R6880:Impg1 UTSW 9 80404800 missense probably damaging 1.00
R7013:Impg1 UTSW 9 80378494 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTCCTATATAAATGCCGTAC -3'
(R):5'- CCTTCATAGGGTAAACCAGGGAG -3'

Sequencing Primer
(F):5'- GGGTCTCCCTAAGTTACTCTGG -3'
(R):5'- AGGTCGTCTGTACTCAGCC -3'
Posted On2016-10-06