Incidental Mutation 'R5468:C2cd2'
ID433379
Institutional Source Beutler Lab
Gene Symbol C2cd2
Ensembl Gene ENSMUSG00000045975
Gene NameC2 calcium-dependent domain containing 2
SynonymsORF25, 5830404H04Rik
MMRRC Submission 043029-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5468 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location97855209-97962598 bp(-) (GRCm38)
Type of Mutationunclassified (1 bp from exon)
DNA Base Change (assembly) C to T at 97868591 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000170757]
Predicted Effect probably null
Transcript: ENSMUST00000170757
SMART Domains Protein: ENSMUSP00000127368
Gene: ENSMUSG00000045975

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 106 122 N/A INTRINSIC
Pfam:C2 232 359 1.9e-6 PFAM
low complexity region 410 421 N/A INTRINSIC
low complexity region 491 517 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231575
Predicted Effect probably benign
Transcript: ENSMUST00000231903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232572
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik C T 7: 44,360,235 R181Q probably damaging Het
Abca13 T A 11: 9,294,062 L1975Q probably damaging Het
Acp2 T A 2: 91,206,098 I180N probably benign Het
Adam12 T C 7: 133,975,473 D221G probably damaging Het
Adamts4 A G 1: 171,252,609 T244A probably benign Het
Adrb2 A T 18: 62,179,625 I43N probably damaging Het
Anxa1 A T 19: 20,378,483 Y207N probably damaging Het
Apba2 T C 7: 64,745,762 L662P probably damaging Het
Arhgap18 T A 10: 26,912,671 I593K probably damaging Het
Arsj T C 3: 126,438,388 V261A possibly damaging Het
Atp7b A T 8: 22,059,970 probably null Het
C530008M17Rik A T 5: 76,840,763 probably benign Het
Cenpf A T 1: 189,652,371 S2571T probably damaging Het
Cep162 A C 9: 87,227,237 L438V probably benign Het
Cfap74 A T 4: 155,426,041 N361I probably benign Het
Cntn5 A G 9: 9,743,628 I548T probably damaging Het
Dglucy A G 12: 100,850,335 N382S probably benign Het
Dnah10 C A 5: 124,830,493 N4306K probably damaging Het
Fam181a A T 12: 103,316,678 M281L probably benign Het
Fam186b A G 15: 99,278,870 I713T possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fry A T 5: 150,399,588 Y1068F probably benign Het
Fubp3 A G 2: 31,603,235 I231V probably benign Het
Gbf1 A G 19: 46,284,296 D1681G possibly damaging Het
Gm10999 G A 8: 129,131,649 P5S probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Impg1 T C 9: 80,465,265 I9V probably benign Het
Lama4 A G 10: 39,072,682 probably null Het
Lamc1 A G 1: 153,233,564 S1161P probably damaging Het
Lipm T A 19: 34,109,554 probably null Het
Lrrc7 G T 3: 158,318,436 N107K probably damaging Het
Lypd8 T C 11: 58,386,760 S123P probably damaging Het
Man2a2 T C 7: 80,352,981 D1084G probably damaging Het
Man2b2 A G 5: 36,807,175 S1000P probably benign Het
Ms4a7 C T 19: 11,322,414 C71Y probably benign Het
Mtus1 A G 8: 41,084,578 S34P probably benign Het
Myo3b A G 2: 70,234,441 N406S probably benign Het
Nbr1 A T 11: 101,572,464 M586L probably benign Het
Nfatc1 C T 18: 80,649,855 R677H probably benign Het
Nlrc3 A C 16: 3,964,035 S503R probably damaging Het
Nlrp9c A T 7: 26,365,000 F968I probably benign Het
Olfr340 A T 2: 36,453,443 N286I probably damaging Het
Olfr881 G A 9: 37,993,011 C168Y probably damaging Het
Olfr951 A G 9: 39,393,961 N57D probably benign Het
Onecut1 A T 9: 74,863,332 T346S probably damaging Het
Pclo A T 5: 14,680,952 K3156M unknown Het
Pigo C T 4: 43,024,562 probably null Het
Plcb4 T C 2: 135,967,152 F580S probably damaging Het
Plekhm2 G T 4: 141,628,100 P879H probably damaging Het
Ppm1e T A 11: 87,230,890 Y747F probably benign Het
Ppwd1 A G 13: 104,225,444 F69L possibly damaging Het
Prss27 C A 17: 24,038,313 Q3K possibly damaging Het
Prss29 T A 17: 25,321,046 N139K possibly damaging Het
Qrich2 T A 11: 116,448,365 T1777S probably damaging Het
Rbp3 A T 14: 33,956,627 H844L possibly damaging Het
Rubcnl G A 14: 75,032,031 C43Y possibly damaging Het
Sec14l5 A G 16: 5,167,140 probably null Het
Sepsecs A T 5: 52,644,014 N435K probably damaging Het
Sfrp1 A G 8: 23,446,210 K223E probably benign Het
Sh3tc2 G A 18: 61,973,431 probably null Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Tmprss7 A G 16: 45,656,448 F817S probably damaging Het
Tril T C 6: 53,819,647 N197D probably damaging Het
Tspan18 T C 2: 93,209,862 T183A probably benign Het
Uroc1 A T 6: 90,338,604 M156L probably benign Het
Wnt16 T C 6: 22,291,161 V196A probably benign Het
Xpnpep1 A G 19: 52,995,519 Y592H probably benign Het
Zfp553 T C 7: 127,237,030 S586P probably benign Het
Zfp619 C T 7: 39,535,728 A394V unknown Het
Zfp985 A G 4: 147,583,245 Y190C probably benign Het
Zmynd10 T A 9: 107,550,337 D309E probably benign Het
Zmynd15 T C 11: 70,461,820 L73P probably damaging Het
Other mutations in C2cd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:C2cd2 APN 16 97870220 missense probably damaging 1.00
IGL01633:C2cd2 APN 16 97875123 splice site probably benign
IGL01731:C2cd2 APN 16 97870172 missense probably damaging 1.00
IGL02071:C2cd2 APN 16 97870232 missense probably damaging 1.00
IGL02086:C2cd2 APN 16 97890008 splice site probably benign
IGL02502:C2cd2 APN 16 97876390 missense possibly damaging 0.85
IGL02933:C2cd2 APN 16 97892201 missense probably benign 0.22
IGL03005:C2cd2 APN 16 97859432 missense probably damaging 0.99
IGL03493:C2cd2 APN 16 97881661 missense probably damaging 0.97
H8562:C2cd2 UTSW 16 97879640 missense possibly damaging 0.91
H8786:C2cd2 UTSW 16 97879640 missense possibly damaging 0.91
R0480:C2cd2 UTSW 16 97877148 missense probably benign 0.45
R0483:C2cd2 UTSW 16 97859588 splice site probably benign
R0541:C2cd2 UTSW 16 97922296 missense possibly damaging 0.66
R1294:C2cd2 UTSW 16 97922269 missense probably damaging 1.00
R1986:C2cd2 UTSW 16 97870271 missense probably damaging 1.00
R2518:C2cd2 UTSW 16 97922086 missense probably benign 0.01
R5507:C2cd2 UTSW 16 97881620 missense probably benign 0.01
R5979:C2cd2 UTSW 16 97875218 missense probably benign 0.01
R6466:C2cd2 UTSW 16 97879622 missense probably benign
R7264:C2cd2 UTSW 16 97876219 critical splice donor site probably null
R7372:C2cd2 UTSW 16 97875380 missense
Predicted Primers PCR Primer
(F):5'- TGCTCACATGCAAGCTTCC -3'
(R):5'- TCTGCTTTGTGCCATCCAGAG -3'

Sequencing Primer
(F):5'- ACATGCAAGCTTCCCACCTTC -3'
(R):5'- TTGTGCCATCCAGAGGCCAC -3'
Posted On2016-10-06