Incidental Mutation 'R5469:Tfip11'
ID433402
Institutional Source Beutler Lab
Gene Symbol Tfip11
Ensembl Gene ENSMUSG00000029345
Gene Nametuftelin interacting protein 11
SynonymsTip39
MMRRC Submission 043030-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5469 (G1)
Quality Score119
Status Not validated
Chromosome5
Chromosomal Location112326358-112338073 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 112334325 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 483 (W483*)
Ref Sequence ENSEMBL: ENSMUSP00000031288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031288] [ENSMUST00000031289] [ENSMUST00000146510] [ENSMUST00000198238]
Predicted Effect probably null
Transcript: ENSMUST00000031288
AA Change: W483*
SMART Domains Protein: ENSMUSP00000031288
Gene: ENSMUSG00000029345
AA Change: W483*

DomainStartEndE-ValueType
Pfam:TIP_N 17 114 1.4e-30 PFAM
G_patch 148 194 3.3e-18 SMART
low complexity region 212 218 N/A INTRINSIC
low complexity region 228 242 N/A INTRINSIC
Pfam:GCFC 398 667 3.4e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031289
SMART Domains Protein: ENSMUSP00000031289
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
Pfam:SRR1 109 164 2.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126736
Predicted Effect probably benign
Transcript: ENSMUST00000146510
SMART Domains Protein: ENSMUSP00000119870
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
Pfam:SRR1 109 162 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156083
Predicted Effect probably benign
Transcript: ENSMUST00000198238
SMART Domains Protein: ENSMUSP00000142844
Gene: ENSMUSG00000029345

DomainStartEndE-ValueType
G_patch 8 54 1.9e-20 SMART
low complexity region 72 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the spliceosome that promotes the release of the lariat-intron during late-stage splicing through the recruitment of a pre-mRNA splicing factor called DEAH-box helicase 15. The encoded protein contains a G-patch domain, a hallmark of RNA-processing proteins, that binds DEAH-box helicase 15. This protein contains an atypical nuclear localization sequence as well as a nuclear speckle-targeting sequence, enabling it to localize to distinct speckled regions within the cell nucleus. Polymorphisms in this gene are associated with dental caries suggesting a role in amelogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,555,306 N331K probably benign Het
Anapc1 G T 2: 128,675,701 S341* probably null Het
Cacna1e T C 1: 154,443,937 E1339G probably damaging Het
Cacna2d1 T A 5: 16,352,678 I702N probably damaging Het
Casp2 C A 6: 42,269,334 H209N probably benign Het
Casr A G 16: 36,510,030 V314A probably benign Het
Ccne2 A T 4: 11,201,353 R294* probably null Het
Cd180 T A 13: 102,704,834 H129Q probably benign Het
Chst10 A T 1: 38,865,527 Y362N probably damaging Het
Ctnna1 T A 18: 35,239,520 D509E probably benign Het
Ctsh G T 9: 90,060,511 probably null Het
Dhx29 C T 13: 112,944,539 A369V possibly damaging Het
Enox1 A G 14: 77,592,974 T340A probably benign Het
Fam135b T A 15: 71,446,043 T1357S probably benign Het
Flt3 A T 5: 147,355,083 S544T possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gsap A T 5: 21,290,544 Y831F possibly damaging Het
Hnrnpr C T 4: 136,319,434 T142M probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Ktn1 A T 14: 47,690,920 E579D probably damaging Het
Lama2 G A 10: 27,041,189 P2247S possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Mphosph10 A T 7: 64,389,445 probably null Het
Pappa C T 4: 65,205,152 T908M probably benign Het
Pdcd10 T A 3: 75,521,057 K150* probably null Het
Piezo2 A T 18: 63,027,864 I2275N probably damaging Het
Pmvk T C 3: 89,467,682 probably null Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Prtg A T 9: 72,891,965 Q759L probably damaging Het
Rad51ap1 C T 6: 126,928,227 S107N probably damaging Het
Rfk T A 19: 17,395,202 N29K probably damaging Het
Ror2 T C 13: 53,117,339 M315V probably benign Het
Rrn3 A G 16: 13,813,100 E600G probably benign Het
Ryk A G 9: 102,906,954 Y593C possibly damaging Het
Slc30a3 T A 5: 31,088,660 D193V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srbd1 C A 17: 86,119,942 C421F possibly damaging Het
Sstr5 A C 17: 25,492,069 V62G probably damaging Het
Tlk1 T C 2: 70,721,668 H553R probably benign Het
Tnc T C 4: 64,013,925 probably null Het
Trav12-1 A G 14: 53,538,473 T27A probably damaging Het
Usp9y G A Y: 1,364,714 T1033I probably benign Het
V1ra8 C T 6: 90,203,204 H130Y probably benign Het
Vmn2r77 A T 7: 86,802,063 M386L probably benign Het
Other mutations in Tfip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Tfip11 APN 5 112329503 missense possibly damaging 0.51
IGL02627:Tfip11 APN 5 112329813 missense possibly damaging 0.69
R0023:Tfip11 UTSW 5 112332009 missense possibly damaging 0.47
R0254:Tfip11 UTSW 5 112335655 missense probably benign 0.06
R0465:Tfip11 UTSW 5 112333264 missense probably benign 0.32
R0569:Tfip11 UTSW 5 112328094 missense probably damaging 1.00
R1411:Tfip11 UTSW 5 112333033 missense probably benign 0.00
R1751:Tfip11 UTSW 5 112334432 missense probably damaging 1.00
R1767:Tfip11 UTSW 5 112334432 missense probably damaging 1.00
R1792:Tfip11 UTSW 5 112329397 missense possibly damaging 0.95
R2125:Tfip11 UTSW 5 112335663 missense possibly damaging 0.46
R4781:Tfip11 UTSW 5 112333399 missense probably damaging 0.99
R4975:Tfip11 UTSW 5 112335747 unclassified probably benign
R5348:Tfip11 UTSW 5 112335668 missense probably benign 0.01
R5385:Tfip11 UTSW 5 112331220 critical splice donor site probably null
R6540:Tfip11 UTSW 5 112334397 unclassified probably null
R6810:Tfip11 UTSW 5 112333597 missense probably benign 0.07
R7199:Tfip11 UTSW 5 112331178 missense probably benign 0.16
R7342:Tfip11 UTSW 5 112327972 start codon destroyed probably null 0.99
R7352:Tfip11 UTSW 5 112333268 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAACTGTGAACTGAGGCTCC -3'
(R):5'- AATGCCATACCTCCTTCTGCAG -3'

Sequencing Primer
(F):5'- TGTCACTGTCAGCACGTG -3'
(R):5'- CTCCTTCTGCAGCTTAGGGAAG -3'
Posted On2016-10-06