Incidental Mutation 'R5470:Cop1'
ID433439
Institutional Source Beutler Lab
Gene Symbol Cop1
Ensembl Gene ENSMUSG00000040782
Gene NameCOP1, E3 ubiquitin ligase
SynonymsCop1
MMRRC Submission 043031-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R5470 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location159232320-159347640 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 159266860 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076894] [ENSMUST00000192215] [ENSMUST00000195044]
Predicted Effect probably benign
Transcript: ENSMUST00000076894
SMART Domains Protein: ENSMUSP00000076160
Gene: ENSMUSG00000040782

DomainStartEndE-ValueType
low complexity region 2 87 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
RING 138 175 3.69e-8 SMART
coiled coil region 235 305 N/A INTRINSIC
WD40 412 451 1.72e0 SMART
WD40 462 501 3.4e-2 SMART
WD40 504 544 3.42e-7 SMART
WD40 547 586 6.79e-2 SMART
WD40 590 628 1.9e-5 SMART
WD40 631 670 4.46e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192215
SMART Domains Protein: ENSMUSP00000141285
Gene: ENSMUSG00000040782

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
RING 68 105 1.8e-10 SMART
coiled coil region 161 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194713
Predicted Effect probably benign
Transcript: ENSMUST00000195044
SMART Domains Protein: ENSMUSP00000141200
Gene: ENSMUSG00000040782

DomainStartEndE-ValueType
WD40 112 151 1.1e-2 SMART
WD40 162 201 2.1e-4 SMART
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in prostate epithelial cells exhibit prostate gland hyperplasia and prostate intraepithelial neoplasia due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,168,941 I813F probably damaging Het
Aqr G A 2: 114,157,575 L169F probably damaging Het
Atp6v1d G A 12: 78,845,284 R182C probably benign Het
Bcl2l13 G T 6: 120,862,872 A44S probably benign Het
Brip1 T C 11: 86,148,542 K389E possibly damaging Het
C530025M09Rik G A 2: 149,831,125 probably benign Het
Ccdc7b T A 8: 129,072,600 S53T possibly damaging Het
Chd8 A G 14: 52,212,609 F154L probably damaging Het
Cyp2c39 A G 19: 39,513,530 K121R possibly damaging Het
Cyp3a57 A G 5: 145,372,619 M256V probably benign Het
Deup1 T C 9: 15,582,620 probably null Het
Dnah10 A G 5: 124,753,168 N709D probably benign Het
Dthd1 A G 5: 62,818,766 Y261C probably damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
En2 C T 5: 28,166,924 T133M probably benign Het
Endou A G 15: 97,718,955 F229S probably damaging Het
Etl4 A T 2: 20,529,980 H79L probably damaging Het
Fah C T 7: 84,593,185 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fignl1 T A 11: 11,802,640 E138D probably benign Het
Fndc3a A G 14: 72,574,568 L311P possibly damaging Het
Gdf9 T A 11: 53,436,754 V179E probably benign Het
Gm14129 G T 2: 148,927,817 noncoding transcript Het
Gorab A G 1: 163,392,509 I188T probably damaging Het
Gpr152 G A 19: 4,143,129 C223Y probably damaging Het
Heatr5b A T 17: 78,821,579 probably null Het
Hsd17b3 G T 13: 64,073,899 T104N probably damaging Het
Il6ra C T 3: 89,885,995 V283M probably benign Het
Klk1b16 A T 7: 44,137,331 I5F probably damaging Het
Krt74 G A 15: 101,754,465 noncoding transcript Het
Lrch3 T A 16: 32,998,590 N650K probably damaging Het
Ly96 A T 1: 16,709,486 E126D probably benign Het
Mgarp C A 3: 51,391,285 R66L possibly damaging Het
Naalad2 T A 9: 18,330,851 T586S probably damaging Het
Ndufaf3 T C 9: 108,566,444 probably benign Het
Neb A G 2: 52,249,438 M3055T possibly damaging Het
Neo1 G T 9: 58,931,067 A478D probably damaging Het
Nmrk1 A T 19: 18,639,884 probably null Het
Nsl1 T C 1: 191,080,540 M184T probably benign Het
Nup133 T C 8: 123,930,966 N410S probably benign Het
Olfr23 T C 11: 73,940,870 I208T probably benign Het
Olfr399 A G 11: 74,053,907 I284T possibly damaging Het
Olfr610 T G 7: 103,506,509 I146L probably benign Het
Opalin A G 19: 41,066,531 S75P probably benign Het
Palb2 C A 7: 122,114,351 C903F probably damaging Het
Pcm1 T A 8: 41,287,683 W989R probably damaging Het
Pfkfb4 T A 9: 109,027,593 I389N probably damaging Het
Pitrm1 T C 13: 6,553,270 C119R probably benign Het
Plekha1 T C 7: 130,908,376 V45A probably damaging Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Rcan2 A G 17: 43,836,283 D4G probably benign Het
Slc12a1 A T 2: 125,170,714 T299S probably damaging Het
Slc22a29 A T 19: 8,161,516 H527Q probably benign Het
Slc22a8 G A 19: 8,607,870 R261H probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco4a1 T C 2: 180,474,114 F681S probably benign Het
Sorcs2 A T 5: 36,031,183 H860Q probably benign Het
Strn A T 17: 78,656,945 H530Q probably benign Het
Tex14 A G 11: 87,551,604 R179G probably damaging Het
Tjp3 T C 10: 81,279,547 D350G probably benign Het
Tnrc6b G T 15: 80,916,711 R1406L possibly damaging Het
Tnxb A G 17: 34,716,973 D2666G probably null Het
Ttn A T 2: 76,729,864 Y27652N probably benign Het
Utp20 T A 10: 88,817,896 E287D probably benign Het
Vmn1r45 T C 6: 89,933,716 I91V probably benign Het
Wdr72 A T 9: 74,139,699 K76* probably null Het
Zfp689 C T 7: 127,444,253 A402T probably damaging Het
Zfpm1 A G 8: 122,333,793 E207G probably damaging Het
Zhx2 G T 15: 57,823,074 R613L possibly damaging Het
Other mutations in Cop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Cop1 APN 1 159308878 unclassified probably benign
IGL02945:Cop1 APN 1 159306689 missense probably benign 0.20
IGL03059:Cop1 APN 1 159306709 missense probably damaging 1.00
R0032:Cop1 UTSW 1 159325036 critical splice donor site probably null
R0179:Cop1 UTSW 1 159250066 missense probably benign 0.20
R0846:Cop1 UTSW 1 159319816 missense probably benign 0.26
R0988:Cop1 UTSW 1 159232847 missense possibly damaging 0.76
R0988:Cop1 UTSW 1 159244672 missense probably damaging 1.00
R2296:Cop1 UTSW 1 159244650 missense possibly damaging 0.92
R2297:Cop1 UTSW 1 159252554 missense possibly damaging 0.53
R2504:Cop1 UTSW 1 159232805 missense probably damaging 0.98
R2974:Cop1 UTSW 1 159324929 missense possibly damaging 0.95
R4889:Cop1 UTSW 1 159284589 missense probably damaging 1.00
R4965:Cop1 UTSW 1 159239597 missense probably damaging 0.99
R4981:Cop1 UTSW 1 159325068 unclassified probably benign
R5124:Cop1 UTSW 1 159278112 missense probably damaging 0.96
R5263:Cop1 UTSW 1 159324937 missense probably damaging 1.00
R5268:Cop1 UTSW 1 159327164 missense probably damaging 1.00
R5595:Cop1 UTSW 1 159250073 missense probably benign 0.00
R5919:Cop1 UTSW 1 159319724 missense probably damaging 1.00
R6386:Cop1 UTSW 1 159289031 missense probably damaging 1.00
R6865:Cop1 UTSW 1 159308954 missense probably damaging 1.00
R6995:Cop1 UTSW 1 159306584 missense probably damaging 1.00
R7056:Cop1 UTSW 1 159250077 missense probably damaging 0.98
R7146:Cop1 UTSW 1 159244352 intron probably null
R7242:Cop1 UTSW 1 159284548 missense probably benign 0.00
R7309:Cop1 UTSW 1 159306625 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCAGTTTAGTCGGCCTTTC -3'
(R):5'- CAGATGTAGTGACCTCAACCC -3'

Sequencing Primer
(F):5'- AGTTTAGTCGGCCTTTCTTGTTTTTC -3'
(R):5'- ATAGCCTCTGAATCTCCCAATG -3'
Posted On2016-10-06