Incidental Mutation 'R0481:Zfp292'
ID43348
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Namezinc finger protein 292
SynonymsZn-16, 5730450D02Rik, Zfp15, Zn-15, Zfp-15, 9430062L07Rik, Krox-10
MMRRC Submission 038681-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R0481 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location34803113-34882960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34810059 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 995 (M995K)
Ref Sequence ENSEMBL: ENSMUSP00000095766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
Predicted Effect probably benign
Transcript: ENSMUST00000047950
AA Change: M1000K

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: M1000K

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098163
AA Change: M995K

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: M995K

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 95% (89/94)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik T C X: 89,752,693 S44P probably damaging Het
9530053A07Rik A T 7: 28,153,749 D1487V probably damaging Het
Abcg4 T A 9: 44,279,369 N39Y probably benign Het
Adamts10 C T 17: 33,549,373 Q840* probably null Het
Aff2 C T X: 69,834,642 T678I probably damaging Het
Ahctf1 A G 1: 179,760,271 V1418A probably benign Het
Ankrd11 G A 8: 122,900,036 R136C probably damaging Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
AW551984 A G 9: 39,600,616 V33A probably null Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bcl9l A G 9: 44,506,682 I606V probably benign Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bicd1 A T 6: 149,511,891 D260V possibly damaging Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccnk A G 12: 108,199,309 probably benign Het
Cd209f A T 8: 4,105,558 probably null Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Cdx1 C T 18: 61,020,492 R158H probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Dhx38 A T 8: 109,556,216 probably benign Het
Dnah5 T A 15: 28,383,599 M2989K probably benign Het
Dpy19l4 A C 4: 11,272,993 probably benign Het
F11r A T 1: 171,461,279 H155L probably benign Het
Fitm2 A G 2: 163,469,714 V193A probably benign Het
Foxk1 T A 5: 142,448,823 S281T probably benign Het
Furin A G 7: 80,393,549 C305R probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Gjb3 T A 4: 127,326,332 I136F probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Glp1r T A 17: 30,931,217 M371K probably benign Het
Gm906 T A 13: 50,246,964 Q442L probably benign Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
H2-M11 A T 17: 36,548,954 R280* probably null Het
Hadhb T A 5: 30,168,545 H78Q probably damaging Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hexa A G 9: 59,555,410 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hyal6 G A 6: 24,743,418 C371Y probably damaging Het
Il1rap T C 16: 26,692,835 Y210H probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnt1 A G 2: 25,892,496 N200S probably damaging Het
Kif27 T A 13: 58,311,264 probably benign Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Macf1 C A 4: 123,484,022 probably null Het
Mamdc4 A G 2: 25,571,216 M1T probably null Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
Mdn1 G A 4: 32,767,182 probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mon2 A G 10: 123,013,396 V1333A possibly damaging Het
Ndst2 T C 14: 20,724,468 D840G possibly damaging Het
Nell2 A T 15: 95,432,682 probably null Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr998 C A 2: 85,591,104 A188E possibly damaging Het
Pde5a C T 3: 122,818,077 probably benign Het
Phip A G 9: 82,876,716 probably benign Het
Polr2b A G 5: 77,332,082 I561V possibly damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rdh1 G T 10: 127,763,124 R158L probably damaging Het
Rhbdl3 T C 11: 80,323,349 probably benign Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rnf13 T A 3: 57,779,451 N88K probably damaging Het
Rnf13 C A 3: 57,807,053 L178I probably damaging Het
Slc17a5 G T 9: 78,538,302 probably null Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Srpk1 G A 17: 28,590,244 probably benign Het
Stk10 A G 11: 32,614,708 K840E probably damaging Het
Suco A G 1: 161,862,313 probably benign Het
T2 G A 17: 8,417,175 probably null Het
Tbc1d5 A G 17: 50,919,051 S255P probably damaging Het
Tenm1 T C X: 42,536,181 Y2254C probably damaging Het
Tex9 T A 9: 72,478,396 K11* probably null Het
Tlr4 A G 4: 66,827,916 I29V probably benign Het
Tmem255a A T X: 38,199,646 V278D probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm3 G A 19: 22,901,071 R622Q possibly damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r53 A T 6: 90,223,718 V208E probably damaging Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Yes1 G T 5: 32,640,405 E23* probably null Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34808683 missense probably benign 0.15
IGL00502:Zfp292 APN 4 34809775 missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34808790 missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34807827 missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34806763 missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34807961 missense probably benign 0.01
IGL01639:Zfp292 APN 4 34809048 missense probably benign 0.04
IGL01688:Zfp292 APN 4 34807855 missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34809244 missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34808810 missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34805416 missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34806462 missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34809415 missense probably benign 0.14
IGL02715:Zfp292 APN 4 34819542 missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34806163 missense probably benign 0.00
F5770:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34807524 missense probably benign 0.00
R0153:Zfp292 UTSW 4 34811185 missense probably benign 0.26
R0184:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34806281 missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34808227 missense probably benign 0.25
R0433:Zfp292 UTSW 4 34839959 missense probably damaging 0.99
R0555:Zfp292 UTSW 4 34807194 missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34807399 missense probably benign 0.02
R0748:Zfp292 UTSW 4 34816424 splice site probably benign
R0782:Zfp292 UTSW 4 34839382 missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34809114 missense probably benign 0.00
R0879:Zfp292 UTSW 4 34811218 missense probably benign 0.00
R1083:Zfp292 UTSW 4 34807569 missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34805238 missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34805397 missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34808935 missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34811237 missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34811043 missense probably benign 0.02
R1837:Zfp292 UTSW 4 34810264 missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34807452 missense probably benign 0.22
R2107:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34810266 missense probably benign 0.13
R2182:Zfp292 UTSW 4 34807417 missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34807962 missense probably benign 0.07
R2306:Zfp292 UTSW 4 34809468 missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34811281 missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34806426 missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34808814 missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34810326 missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34807744 missense probably benign 0.00
R4006:Zfp292 UTSW 4 34809611 missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34806079 missense probably benign 0.04
R4641:Zfp292 UTSW 4 34807828 missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34807078 missense probably benign 0.00
R4718:Zfp292 UTSW 4 34819521 missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34808917 missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34839878 missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34809755 missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34805842 missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34807491 missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34806261 missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34811703 missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34806747 missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34805125 missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34805464 missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34811902 missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34808497 missense probably benign 0.13
R6209:Zfp292 UTSW 4 34809442 missense probably benign 0.14
R6275:Zfp292 UTSW 4 34808883 missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34816301 missense probably benign 0.21
R6747:Zfp292 UTSW 4 34806894 missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34807812 missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34816357 missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34806796 missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34808679 missense probably benign
R7254:Zfp292 UTSW 4 34819476 missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34806839 missense probably benign
R7378:Zfp292 UTSW 4 34808384 missense probably benign 0.26
V7580:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCGGGCTGTGACTGAACAAATGTG -3'
(R):5'- TGTGTCCATCAAGGTGTCTGTCAAC -3'

Sequencing Primer
(F):5'- GTGACTGAACAAATGTGATACTTTC -3'
(R):5'- TGACTTTGGAAAGCAAGAAAACC -3'
Posted On2013-05-23