Incidental Mutation 'R5470:Tnrc6b'
ID433493
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Nametrinucleotide repeat containing 6b
Synonyms
MMRRC Submission 043031-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R5470 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80711313-80941085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80916711 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1406 (R1406L)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067689
AA Change: R1406L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: R1406L

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228071
Predicted Effect unknown
Transcript: ENSMUST00000228124
AA Change: R553L
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,168,941 I813F probably damaging Het
Aqr G A 2: 114,157,575 L169F probably damaging Het
Atp6v1d G A 12: 78,845,284 R182C probably benign Het
Bcl2l13 G T 6: 120,862,872 A44S probably benign Het
Brip1 T C 11: 86,148,542 K389E possibly damaging Het
C530025M09Rik G A 2: 149,831,125 probably benign Het
Ccdc7b T A 8: 129,072,600 S53T possibly damaging Het
Chd8 A G 14: 52,212,609 F154L probably damaging Het
Cop1 A T 1: 159,266,860 probably benign Het
Cyp2c39 A G 19: 39,513,530 K121R possibly damaging Het
Cyp3a57 A G 5: 145,372,619 M256V probably benign Het
Deup1 T C 9: 15,582,620 probably null Het
Dnah10 A G 5: 124,753,168 N709D probably benign Het
Dthd1 A G 5: 62,818,766 Y261C probably damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
En2 C T 5: 28,166,924 T133M probably benign Het
Endou A G 15: 97,718,955 F229S probably damaging Het
Etl4 A T 2: 20,529,980 H79L probably damaging Het
Fah C T 7: 84,593,185 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fignl1 T A 11: 11,802,640 E138D probably benign Het
Fndc3a A G 14: 72,574,568 L311P possibly damaging Het
Gdf9 T A 11: 53,436,754 V179E probably benign Het
Gm14129 G T 2: 148,927,817 noncoding transcript Het
Gorab A G 1: 163,392,509 I188T probably damaging Het
Gpr152 G A 19: 4,143,129 C223Y probably damaging Het
Heatr5b A T 17: 78,821,579 probably null Het
Hsd17b3 G T 13: 64,073,899 T104N probably damaging Het
Il6ra C T 3: 89,885,995 V283M probably benign Het
Klk1b16 A T 7: 44,137,331 I5F probably damaging Het
Krt74 G A 15: 101,754,465 noncoding transcript Het
Lrch3 T A 16: 32,998,590 N650K probably damaging Het
Ly96 A T 1: 16,709,486 E126D probably benign Het
Mgarp C A 3: 51,391,285 R66L possibly damaging Het
Naalad2 T A 9: 18,330,851 T586S probably damaging Het
Ndufaf3 T C 9: 108,566,444 probably benign Het
Neb A G 2: 52,249,438 M3055T possibly damaging Het
Neo1 G T 9: 58,931,067 A478D probably damaging Het
Nmrk1 A T 19: 18,639,884 probably null Het
Nsl1 T C 1: 191,080,540 M184T probably benign Het
Nup133 T C 8: 123,930,966 N410S probably benign Het
Olfr23 T C 11: 73,940,870 I208T probably benign Het
Olfr399 A G 11: 74,053,907 I284T possibly damaging Het
Olfr610 T G 7: 103,506,509 I146L probably benign Het
Opalin A G 19: 41,066,531 S75P probably benign Het
Palb2 C A 7: 122,114,351 C903F probably damaging Het
Pcm1 T A 8: 41,287,683 W989R probably damaging Het
Pfkfb4 T A 9: 109,027,593 I389N probably damaging Het
Pitrm1 T C 13: 6,553,270 C119R probably benign Het
Plekha1 T C 7: 130,908,376 V45A probably damaging Het
Pold2 G A 11: 5,873,048 P376S probably damaging Het
Rcan2 A G 17: 43,836,283 D4G probably benign Het
Slc12a1 A T 2: 125,170,714 T299S probably damaging Het
Slc22a29 A T 19: 8,161,516 H527Q probably benign Het
Slc22a8 G A 19: 8,607,870 R261H probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco4a1 T C 2: 180,474,114 F681S probably benign Het
Sorcs2 A T 5: 36,031,183 H860Q probably benign Het
Strn A T 17: 78,656,945 H530Q probably benign Het
Tex14 A G 11: 87,551,604 R179G probably damaging Het
Tjp3 T C 10: 81,279,547 D350G probably benign Het
Tnxb A G 17: 34,716,973 D2666G probably null Het
Ttn A T 2: 76,729,864 Y27652N probably benign Het
Utp20 T A 10: 88,817,896 E287D probably benign Het
Vmn1r45 T C 6: 89,933,716 I91V probably benign Het
Wdr72 A T 9: 74,139,699 K76* probably null Het
Zfp689 C T 7: 127,444,253 A402T probably damaging Het
Zfpm1 A G 8: 122,333,793 E207G probably damaging Het
Zhx2 G T 15: 57,823,074 R613L possibly damaging Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 unclassified probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 unclassified probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7453:Tnrc6b UTSW 15 80902555 small deletion probably benign
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACGGCCGTGCTTTTATTAATG -3'
(R):5'- CAGAGCCTGAATGTCATTGAAC -3'

Sequencing Primer
(F):5'- TATTCCCAACACAGGTCATAAGAGGG -3'
(R):5'- CATTGAACTATTCTAGGAAAGGCAG -3'
Posted On2016-10-06