Incidental Mutation 'R5528:Clcn1'
ID 433525
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Name chloride channel, voltage-sensitive 1
Synonyms Clc1, SMCC1, NMF355, Clc-1, nmf355
MMRRC Submission 043086-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5528 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42263619-42292690 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 42277275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 455 (N455K)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
AlphaFold Q64347
Predicted Effect probably benign
Transcript: ENSMUST00000031894
AA Change: N455K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: N455K

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: N383K
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: N383K

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,772,260 (GRCm39) L483P probably benign Het
4930519G04Rik T G 5: 115,012,415 (GRCm39) probably null Het
Ablim2 C T 5: 36,013,510 (GRCm39) Q148* probably null Het
Ap3s2 A T 7: 79,530,234 (GRCm39) *194R probably null Het
Arpp21 C T 9: 111,978,421 (GRCm39) A235T probably benign Het
C9orf72 T C 4: 35,213,556 (GRCm39) D198G probably benign Het
Ccdc33 T C 9: 57,936,078 (GRCm39) D939G probably benign Het
Celsr2 A T 3: 108,320,610 (GRCm39) I734N probably damaging Het
Cpne8 C T 15: 90,503,893 (GRCm39) V91I possibly damaging Het
Cstdc7 A G 18: 42,306,727 (GRCm39) probably null Het
Ddx1 A G 12: 13,279,295 (GRCm39) V448A probably damaging Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Eeig1 G A 2: 32,456,339 (GRCm39) A334T probably damaging Het
Eif2a G T 3: 58,455,933 (GRCm39) D311Y probably damaging Het
Eif2ak4 G A 2: 118,258,419 (GRCm39) E512K probably damaging Het
Esp15 A T 17: 39,955,640 (GRCm39) Y69F probably benign Het
Gucy1a1 A T 3: 82,016,380 (GRCm39) Y203N probably damaging Het
Hook3 T C 8: 26,562,321 (GRCm39) Q248R probably damaging Het
Ifit2 T A 19: 34,550,937 (GRCm39) V159E possibly damaging Het
Il17rd T C 14: 26,810,024 (GRCm39) V20A possibly damaging Het
Kcnq3 T A 15: 65,897,027 (GRCm39) D291V probably damaging Het
Klf11 A T 12: 24,704,929 (GRCm39) M111L probably benign Het
Lama5 T A 2: 179,836,356 (GRCm39) H1165L probably benign Het
Lmo7 A G 14: 102,139,522 (GRCm39) N702S probably damaging Het
Lta4h T C 10: 93,307,736 (GRCm39) V323A probably damaging Het
Mkrn3 T C 7: 62,068,735 (GRCm39) E352G possibly damaging Het
Ms4a19 T C 19: 11,118,999 (GRCm39) S37G possibly damaging Het
Mtf2 T A 5: 108,242,023 (GRCm39) L277Q probably damaging Het
Myo9b A G 8: 71,775,918 (GRCm39) N370D probably benign Het
Nlrp4e A C 7: 23,036,316 (GRCm39) K723T probably benign Het
Nsun3 A G 16: 62,555,689 (GRCm39) V279A possibly damaging Het
Pde6b A G 5: 108,571,424 (GRCm39) D459G probably benign Het
Phgdh T C 3: 98,235,655 (GRCm39) I121V probably benign Het
Pik3r5 T C 11: 68,386,803 (GRCm39) C811R probably damaging Het
Spaca6 A C 17: 18,051,344 (GRCm39) I27L probably benign Het
Trmt1l G A 1: 151,330,746 (GRCm39) V588I probably benign Het
Tshr A G 12: 91,503,967 (GRCm39) N302D probably damaging Het
Vmn2r23 A G 6: 123,689,961 (GRCm39) D279G probably damaging Het
Wnt3a T C 11: 59,166,106 (GRCm39) N58S probably damaging Het
Zkscan8 A G 13: 21,704,895 (GRCm39) V276A probably damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42,268,637 (GRCm39) missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42,287,606 (GRCm39) splice site probably benign
IGL02055:Clcn1 APN 6 42,284,489 (GRCm39) missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42,284,007 (GRCm39) splice site probably benign
IGL02649:Clcn1 APN 6 42,275,763 (GRCm39) missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42,263,714 (GRCm39) splice site probably null
IGL03148:Clcn1 APN 6 42,276,925 (GRCm39) critical splice donor site probably null
IGL03190:Clcn1 APN 6 42,267,037 (GRCm39) missense probably benign 0.02
IGL03327:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
IGL03346:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
Faint UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
jack_spratt UTSW 6 42,287,515 (GRCm39) missense probably benign
Limitations UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
maimed UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
stunted UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R0167:Clcn1 UTSW 6 42,263,770 (GRCm39) missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42,287,074 (GRCm39) missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42,287,515 (GRCm39) missense probably benign
R0573:Clcn1 UTSW 6 42,289,979 (GRCm39) splice site probably null
R0615:Clcn1 UTSW 6 42,282,509 (GRCm39) missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42,290,075 (GRCm39) missense probably benign 0.00
R1562:Clcn1 UTSW 6 42,277,169 (GRCm39) missense probably benign 0.29
R1566:Clcn1 UTSW 6 42,268,374 (GRCm39) missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42,290,032 (GRCm39) missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42,271,079 (GRCm39) missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42,275,860 (GRCm39) critical splice donor site probably null
R1861:Clcn1 UTSW 6 42,290,925 (GRCm39) missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42,268,559 (GRCm39) missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42,290,046 (GRCm39) missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42,275,784 (GRCm39) missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42,267,112 (GRCm39) missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42,269,929 (GRCm39) missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42,286,902 (GRCm39) missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42,267,131 (GRCm39) splice site probably null
R4836:Clcn1 UTSW 6 42,286,898 (GRCm39) missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42,287,922 (GRCm39) nonsense probably null
R5085:Clcn1 UTSW 6 42,290,814 (GRCm39) missense probably benign 0.41
R5628:Clcn1 UTSW 6 42,275,823 (GRCm39) missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42,269,900 (GRCm39) missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42,277,208 (GRCm39) nonsense probably null
R6175:Clcn1 UTSW 6 42,291,096 (GRCm39) missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42,290,172 (GRCm39) missense possibly damaging 0.82
R6394:Clcn1 UTSW 6 42,284,524 (GRCm39) missense possibly damaging 0.84
R7012:Clcn1 UTSW 6 42,267,542 (GRCm39) missense probably benign 0.01
R7020:Clcn1 UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42,284,477 (GRCm39) missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42,268,323 (GRCm39) missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42,270,396 (GRCm39) missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42,275,772 (GRCm39) missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42,268,268 (GRCm39) nonsense probably null
R7663:Clcn1 UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
R7807:Clcn1 UTSW 6 42,287,282 (GRCm39) splice site probably null
R7954:Clcn1 UTSW 6 42,263,625 (GRCm39) unclassified probably benign
R8026:Clcn1 UTSW 6 42,284,595 (GRCm39) critical splice donor site probably null
R8045:Clcn1 UTSW 6 42,267,628 (GRCm39) missense probably damaging 1.00
R8499:Clcn1 UTSW 6 42,284,133 (GRCm39) missense probably damaging 1.00
R8523:Clcn1 UTSW 6 42,284,523 (GRCm39) nonsense probably null
R8677:Clcn1 UTSW 6 42,267,519 (GRCm39) critical splice acceptor site probably null
R8818:Clcn1 UTSW 6 42,282,477 (GRCm39) missense probably damaging 0.98
R8945:Clcn1 UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R9012:Clcn1 UTSW 6 42,268,567 (GRCm39) missense possibly damaging 0.75
R9295:Clcn1 UTSW 6 42,290,883 (GRCm39) missense probably benign 0.00
R9433:Clcn1 UTSW 6 42,282,494 (GRCm39) missense probably damaging 1.00
R9513:Clcn1 UTSW 6 42,282,462 (GRCm39) missense probably damaging 1.00
R9679:Clcn1 UTSW 6 42,263,753 (GRCm39) missense probably damaging 0.98
Z1088:Clcn1 UTSW 6 42,284,190 (GRCm39) missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42,277,294 (GRCm39) missense probably benign 0.40
Z1176:Clcn1 UTSW 6 42,284,501 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGGCTGGGGATACATTC -3'
(R):5'- CATCACTAGATTGCCATGAATGGAG -3'

Sequencing Primer
(F):5'- CAGGCTGGGGATACATTCTCTAAC -3'
(R):5'- CCTAGTTCATTTTGATAGACAGGC -3'
Posted On 2016-10-06