Incidental Mutation 'R5528:Ap3s2'
List |< first << previous [record 54 of 958] next >> last >|
ID433529
Institutional Source Beutler Lab
Gene Symbol Ap3s2
Ensembl Gene ENSMUSG00000063801
Gene Nameadaptor-related protein complex 3, sigma 2 subunit
Synonymssigma 3B, [s]3B
MMRRC Submission 043086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R5528 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79875325-79920649 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 79880486 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 194 (*194R)
Ref Sequence ENSEMBL: ENSMUSP00000075082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075657] [ENSMUST00000206725]
Predicted Effect probably null
Transcript: ENSMUST00000075657
AA Change: *194R
SMART Domains Protein: ENSMUSP00000075082
Gene: ENSMUSG00000063801
AA Change: *194R

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 148 9.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206725
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,499 L483P probably benign Het
1700025F22Rik T C 19: 11,141,635 S37G possibly damaging Het
3110043O21Rik T C 4: 35,213,556 D198G probably benign Het
4930519G04Rik T G 5: 114,874,354 probably null Het
Ablim2 C T 5: 35,856,166 Q148* probably null Het
Arpp21 C T 9: 112,149,353 A235T probably benign Het
Ccdc33 T C 9: 58,028,795 D939G probably benign Het
Celsr2 A T 3: 108,413,294 I734N probably damaging Het
Clcn1 C A 6: 42,300,341 N455K probably benign Het
Cpne8 C T 15: 90,619,690 V91I possibly damaging Het
Ddx1 A G 12: 13,229,294 V448A probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eif2a G T 3: 58,548,512 D311Y probably damaging Het
Eif2ak4 G A 2: 118,427,938 E512K probably damaging Het
Esp15 A T 17: 39,644,749 Y69F probably benign Het
Fam102a G A 2: 32,566,327 A334T probably damaging Het
Gm5689 A G 18: 42,173,662 probably null Het
Gucy1a1 A T 3: 82,109,073 Y203N probably damaging Het
Hook3 T C 8: 26,072,293 Q248R probably damaging Het
Ifit2 T A 19: 34,573,537 V159E possibly damaging Het
Il17rd T C 14: 27,088,067 V20A possibly damaging Het
Kcnq3 T A 15: 66,025,178 D291V probably damaging Het
Klf11 A T 12: 24,654,930 M111L probably benign Het
Lama5 T A 2: 180,194,563 H1165L probably benign Het
Lmo7 A G 14: 101,902,086 N702S probably damaging Het
Lta4h T C 10: 93,471,874 V323A probably damaging Het
Mkrn3 T C 7: 62,418,987 E352G possibly damaging Het
Mtf2 T A 5: 108,094,157 L277Q probably damaging Het
Myo9b A G 8: 71,323,274 N370D probably benign Het
Nlrp4e A C 7: 23,336,891 K723T probably benign Het
Nsun3 A G 16: 62,735,326 V279A possibly damaging Het
Pde6b A G 5: 108,423,558 D459G probably benign Het
Phgdh T C 3: 98,328,339 I121V probably benign Het
Pik3r5 T C 11: 68,495,977 C811R probably damaging Het
Spaca6 A C 17: 17,831,082 I27L probably benign Het
Trmt1l G A 1: 151,454,995 V588I probably benign Het
Tshr A G 12: 91,537,193 N302D probably damaging Het
Vmn2r23 A G 6: 123,713,002 D279G probably damaging Het
Wnt3a T C 11: 59,275,280 N58S probably damaging Het
Zkscan8 A G 13: 21,520,725 V276A probably damaging Het
Other mutations in Ap3s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ap3s2 APN 7 79916076 missense probably benign 0.35
R0138:Ap3s2 UTSW 7 79909869 missense probably benign 0.28
R0909:Ap3s2 UTSW 7 79880518 missense probably benign 0.01
R1711:Ap3s2 UTSW 7 79880490 missense probably damaging 0.98
R4909:Ap3s2 UTSW 7 79915241 missense possibly damaging 0.90
R5041:Ap3s2 UTSW 7 79920519 missense probably benign 0.07
R5630:Ap3s2 UTSW 7 79909899 missense probably damaging 1.00
R6725:Ap3s2 UTSW 7 79920642 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCCCTGATGTCTATCACAGC -3'
(R):5'- TGGAATGCTTTAGATCTCTGTCATC -3'

Sequencing Primer
(F):5'- CACAGCCGTGAGTCAGGAG -3'
(R):5'- CTGCTTTAGGATTTAAGCAGACGAC -3'
Posted On2016-10-06