Incidental Mutation 'R0481:Hectd4'
ID43360
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene NameHECT domain E3 ubiquitin protein ligase 4
SynonymsGm15800
MMRRC Submission 038681-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R0481 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121220219-121368577 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 121295506 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614]
Predicted Effect probably benign
Transcript: ENSMUST00000042614
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128514
Predicted Effect probably benign
Transcript: ENSMUST00000148368
Predicted Effect probably benign
Transcript: ENSMUST00000201669
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 95% (89/94)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik T C X: 89,752,693 S44P probably damaging Het
9530053A07Rik A T 7: 28,153,749 D1487V probably damaging Het
Abcg4 T A 9: 44,279,369 N39Y probably benign Het
Adamts10 C T 17: 33,549,373 Q840* probably null Het
Aff2 C T X: 69,834,642 T678I probably damaging Het
Ahctf1 A G 1: 179,760,271 V1418A probably benign Het
Ankrd11 G A 8: 122,900,036 R136C probably damaging Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
AW551984 A G 9: 39,600,616 V33A probably null Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bcl9l A G 9: 44,506,682 I606V probably benign Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bicd1 A T 6: 149,511,891 D260V possibly damaging Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccnk A G 12: 108,199,309 probably benign Het
Cd209f A T 8: 4,105,558 probably null Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Cdx1 C T 18: 61,020,492 R158H probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Dhx38 A T 8: 109,556,216 probably benign Het
Dnah5 T A 15: 28,383,599 M2989K probably benign Het
Dpy19l4 A C 4: 11,272,993 probably benign Het
F11r A T 1: 171,461,279 H155L probably benign Het
Fitm2 A G 2: 163,469,714 V193A probably benign Het
Foxk1 T A 5: 142,448,823 S281T probably benign Het
Furin A G 7: 80,393,549 C305R probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Gjb3 T A 4: 127,326,332 I136F probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Glp1r T A 17: 30,931,217 M371K probably benign Het
Gm906 T A 13: 50,246,964 Q442L probably benign Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
H2-M11 A T 17: 36,548,954 R280* probably null Het
Hadhb T A 5: 30,168,545 H78Q probably damaging Het
Hexa A G 9: 59,555,410 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hyal6 G A 6: 24,743,418 C371Y probably damaging Het
Il1rap T C 16: 26,692,835 Y210H probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnt1 A G 2: 25,892,496 N200S probably damaging Het
Kif27 T A 13: 58,311,264 probably benign Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Macf1 C A 4: 123,484,022 probably null Het
Mamdc4 A G 2: 25,571,216 M1T probably null Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
Mdn1 G A 4: 32,767,182 probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mon2 A G 10: 123,013,396 V1333A possibly damaging Het
Ndst2 T C 14: 20,724,468 D840G possibly damaging Het
Nell2 A T 15: 95,432,682 probably null Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr998 C A 2: 85,591,104 A188E possibly damaging Het
Pde5a C T 3: 122,818,077 probably benign Het
Phip A G 9: 82,876,716 probably benign Het
Polr2b A G 5: 77,332,082 I561V possibly damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rdh1 G T 10: 127,763,124 R158L probably damaging Het
Rhbdl3 T C 11: 80,323,349 probably benign Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rnf13 T A 3: 57,779,451 N88K probably damaging Het
Rnf13 C A 3: 57,807,053 L178I probably damaging Het
Slc17a5 G T 9: 78,538,302 probably null Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Srpk1 G A 17: 28,590,244 probably benign Het
Stk10 A G 11: 32,614,708 K840E probably damaging Het
Suco A G 1: 161,862,313 probably benign Het
T2 G A 17: 8,417,175 probably null Het
Tbc1d5 A G 17: 50,919,051 S255P probably damaging Het
Tenm1 T C X: 42,536,181 Y2254C probably damaging Het
Tex9 T A 9: 72,478,396 K11* probably null Het
Tlr4 A G 4: 66,827,916 I29V probably benign Het
Tmem255a A T X: 38,199,646 V278D probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm3 G A 19: 22,901,071 R622Q possibly damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r53 A T 6: 90,223,718 V208E probably damaging Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Yes1 G T 5: 32,640,405 E23* probably null Het
Zfp292 A T 4: 34,810,059 M995K probably benign Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
PIT4466001:Hectd4 UTSW 5 121333060 critical splice donor site probably null
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 synonymous probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 unclassified probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121273629 missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121308342 missense probably benign 0.01
R7234:Hectd4 UTSW 5 121329073 missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121314881 missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121310663 missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121281932 missense probably benign 0.00
R7467:Hectd4 UTSW 5 121323961 missense possibly damaging 0.66
R7482:Hectd4 UTSW 5 121363878 missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121297109 missense not run
R7525:Hectd4 UTSW 5 121343665 missense not run
R7560:Hectd4 UTSW 5 121254342 missense not run
R7561:Hectd4 UTSW 5 121291225 missense not run
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTCACTGCACTGAGTTTCTACTGG -3'
(R):5'- TCGTCACAGCACTAAGGCAAATGG -3'

Sequencing Primer
(F):5'- GTGCATTACTCATCACAAGACTGG -3'
(R):5'- tgggaggcagaggcaag -3'
Posted On2013-05-23