Incidental Mutation 'R5530:Wdr19'
ID433627
Institutional Source Beutler Lab
Gene Symbol Wdr19
Ensembl Gene ENSMUSG00000037890
Gene NameWD repeat domain 19
Synonyms
MMRRC Submission 043088-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5530 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location65199696-65260415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65228219 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 555 (S555P)
Ref Sequence ENSEMBL: ENSMUSP00000144866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000203653]
Predicted Effect probably benign
Transcript: ENSMUST00000041892
AA Change: S555P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890
AA Change: S555P

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203359
Predicted Effect probably benign
Transcript: ENSMUST00000203653
AA Change: S555P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890
AA Change: S555P

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204647
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD (tryptophan-aspartic acid) repeat family, which is a large family of structurally-related proteins known to participate in a wide range of cellular processes. Each WD repeat typically contains about 40 amino acids that are usually bracketed by glycine-histidine and tryptophan-aspartic acid (WD) dipeptides. This protein contains six WD repeats, three transmembrane domains, and a clathrin heavy-chain repeat. Mutations in this gene have been described in individuals with a wide range of disorders affecting function of the cilium. These disorders are known as ciliopathies, and include Jeune syndrome, Sensenbrenner syndromes, Senior-Loken syndrome, combined or isolated nephronophthisis (NPHP), and retinitis pigmentosa (RP). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415F23Rik A T 1: 23,101,990 I81N probably damaging Het
Abcb6 A G 1: 75,177,912 probably benign Het
Anapc2 A G 2: 25,284,583 K653E possibly damaging Het
Aplp1 T C 7: 30,436,829 S508G possibly damaging Het
Bend3 T A 10: 43,511,726 V705D probably damaging Het
Btaf1 C A 19: 36,990,775 A1120E possibly damaging Het
Carmil3 T C 14: 55,493,624 V116A probably damaging Het
Cdk5rap3 A T 11: 96,911,633 Y238* probably null Het
Cep170 T C 1: 176,769,510 H427R probably benign Het
Cubn G A 2: 13,308,523 R3079W probably damaging Het
Edc4 G T 8: 105,889,254 E694* probably null Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Fam189a2 T A 19: 23,975,594 T451S probably benign Het
Fbxo46 T C 7: 19,136,802 Y449H probably damaging Het
Ficd C A 5: 113,738,925 P387Q probably damaging Het
Grin2b T C 6: 135,733,723 T942A probably benign Het
Hoxb1 G C 11: 96,366,928 R228P probably damaging Het
Jmjd1c T C 10: 67,249,762 F2444L probably damaging Het
Kcnj2 T C 11: 111,072,091 F103S probably damaging Het
Mapkbp1 A G 2: 120,015,355 I402V probably benign Het
Mvp A G 7: 126,995,923 V250A probably benign Het
Myo1b T A 1: 51,797,423 N293I probably damaging Het
Npy5r T A 8: 66,680,860 Y427F probably benign Het
Nrd1 C T 4: 109,047,609 T747M probably damaging Het
Nrxn2 C T 19: 6,498,367 P30L possibly damaging Het
Nt5dc3 T C 10: 86,820,993 F332S probably damaging Het
Olfr116 A G 17: 37,623,807 I276T possibly damaging Het
Olfr876 A G 9: 37,804,807 T299A probably benign Het
Optc T G 1: 133,905,090 T91P probably benign Het
Otud7b A T 3: 96,141,488 E92V probably damaging Het
Pla2g4d A G 2: 120,269,555 I677T probably benign Het
Pot1a T C 6: 25,778,894 E67G probably damaging Het
Ppil6 T C 10: 41,507,498 S257P probably damaging Het
Ppp1r14a T C 7: 29,289,366 L11P probably benign Het
Pramef12 A T 4: 144,392,662 M445K probably benign Het
Rad21l A T 2: 151,657,510 I257K probably benign Het
Rbm11 A G 16: 75,592,973 D9G possibly damaging Het
Rhbdf2 T C 11: 116,600,662 Y586C probably damaging Het
Rxfp2 A T 5: 150,056,810 I276F probably damaging Het
Sec14l4 A G 11: 4,046,342 *404W probably null Het
Sec16a A G 2: 26,439,252 V917A probably benign Het
Sec61a2 A T 2: 5,882,650 Y131* probably null Het
Soga1 T A 2: 157,020,342 S1556C probably damaging Het
Sspo A T 6: 48,465,583 Y2004F probably damaging Het
Stab2 T C 10: 86,947,162 E674G probably benign Het
Tmem246 A G 4: 49,586,226 L314P probably benign Het
Tmf1 A G 6: 97,158,087 S989P probably damaging Het
Tshz1 T C 18: 84,013,268 D1005G probably damaging Het
Zdhhc24 T A 19: 4,883,563 probably null Het
Zfp558 A G 9: 18,456,373 M373T probably benign Het
Other mutations in Wdr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Wdr19 APN 5 65252299 missense probably benign 0.41
IGL01346:Wdr19 APN 5 65221739 splice site probably benign
IGL01761:Wdr19 APN 5 65215820 missense possibly damaging 0.60
IGL01845:Wdr19 APN 5 65225366 missense probably damaging 0.98
IGL01977:Wdr19 APN 5 65228569 missense probably benign
IGL02314:Wdr19 APN 5 65257120 missense probably benign 0.26
IGL02455:Wdr19 APN 5 65224759 missense probably benign 0.01
IGL02542:Wdr19 APN 5 65231071 missense probably benign
IGL02616:Wdr19 APN 5 65223581 missense probably damaging 0.97
IGL02661:Wdr19 APN 5 65245808 missense probably benign 0.06
IGL02927:Wdr19 APN 5 65252378 missense possibly damaging 0.80
IGL02958:Wdr19 APN 5 65212807 splice site probably null
IGL03083:Wdr19 APN 5 65230976 missense probably benign 0.01
IGL03332:Wdr19 APN 5 65227143 missense possibly damaging 0.89
detritus UTSW 5 65212891 missense possibly damaging 0.59
refuse UTSW 5 65228292 missense possibly damaging 0.64
R0924:Wdr19 UTSW 5 65256439 splice site probably benign
R1178:Wdr19 UTSW 5 65223865 missense probably damaging 0.98
R1229:Wdr19 UTSW 5 65256391 missense possibly damaging 0.94
R1434:Wdr19 UTSW 5 65223504 splice site probably benign
R1543:Wdr19 UTSW 5 65224690 missense probably benign 0.06
R1819:Wdr19 UTSW 5 65212891 missense possibly damaging 0.59
R1971:Wdr19 UTSW 5 65241160 splice site probably benign
R2190:Wdr19 UTSW 5 65244166 missense possibly damaging 0.89
R2274:Wdr19 UTSW 5 65240991 missense possibly damaging 0.62
R3106:Wdr19 UTSW 5 65202623 missense probably benign 0.20
R3753:Wdr19 UTSW 5 65224726 missense probably damaging 1.00
R3893:Wdr19 UTSW 5 65228292 missense possibly damaging 0.64
R4609:Wdr19 UTSW 5 65228542 missense possibly damaging 0.83
R5284:Wdr19 UTSW 5 65225409 missense probably damaging 1.00
R5328:Wdr19 UTSW 5 65244179 missense probably damaging 1.00
R5837:Wdr19 UTSW 5 65202957 missense probably benign 0.08
R5902:Wdr19 UTSW 5 65227139 missense probably benign 0.09
R6065:Wdr19 UTSW 5 65221713 missense probably benign
R6419:Wdr19 UTSW 5 65215893 missense possibly damaging 0.63
R6495:Wdr19 UTSW 5 65258123 missense probably benign 0.00
R6916:Wdr19 UTSW 5 65225334 missense possibly damaging 0.64
R7020:Wdr19 UTSW 5 65256314 missense probably damaging 0.99
X0028:Wdr19 UTSW 5 65244144 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAAAGAGAAGCTCTCCTGCC -3'
(R):5'- GCTAATGCCTGGCACAAATATCAG -3'

Sequencing Primer
(F):5'- TGCCGAGGAGAGCTGCTG -3'
(R):5'- GAAAGCTTTCAACTTCACTGCAATGG -3'
Posted On2016-10-06