Incidental Mutation 'R5531:Mcm3'
ID433666
Institutional Source Beutler Lab
Gene Symbol Mcm3
Ensembl Gene ENSMUSG00000041859
Gene Nameminichromosome maintenance complex component 3
SynonymsP1, p1.m, Mcmd
MMRRC Submission 043089-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5531 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20802968-20820312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20803544 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 784 (F784Y)
Ref Sequence ENSEMBL: ENSMUSP00000059192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053266]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053266
AA Change: F784Y

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059192
Gene: ENSMUSG00000041859
AA Change: F784Y

DomainStartEndE-ValueType
MCM 109 654 N/A SMART
AAA 337 490 1.92e-4 SMART
coiled coil region 655 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191061
Meta Mutation Damage Score 0.0884 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein is a subunit of the protein complex that consists of MCM2-7. It has been shown to interact directly with MCM5/CDC46. This protein also interacts with and is acetylated by MCM3AP, a chromatin-associated acetyltransferase. The acetylation of this protein inhibits the initiation of DNA replication and cell cycle progression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null or hypomorph alleles exhibit prenatal lethality. Fetal mice homozygous for a hypomorphic allele display anemia and replicative stress during fetal erythropoiesis. Mice heterozygous for null or hypomorph alleles display increased incidence of lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,753,672 S647P possibly damaging Het
Acacb T C 5: 114,204,706 F878L possibly damaging Het
Acr T A 15: 89,573,943 Y276N probably damaging Het
AI987944 A T 7: 41,374,390 Y388* probably null Het
Ankrd29 G A 18: 12,279,778 T114I probably damaging Het
Ap5z1 T C 5: 142,467,781 M168T probably benign Het
Bard1 A C 1: 71,046,721 C608W probably damaging Het
Clspn A G 4: 126,577,773 R907G probably benign Het
Cubn C T 2: 13,350,932 V1830I probably benign Het
Cwc22 T C 2: 77,924,569 N221S probably damaging Het
Dact3 A G 7: 16,875,615 E64G possibly damaging Het
Dhx40 T C 11: 86,789,504 E381G possibly damaging Het
Dnah7a A G 1: 53,419,748 S3744P possibly damaging Het
Epha4 A G 1: 77,374,876 V914A probably benign Het
Fbxw10 G A 11: 62,862,656 C492Y probably damaging Het
G930045G22Rik C A 6: 50,847,776 noncoding transcript Het
Gm21103 A T 14: 6,303,861 I63K probably damaging Het
Gpr156 T C 16: 38,005,257 V612A probably benign Het
Gucy2g A G 19: 55,241,140 S33P probably benign Het
Hibch A G 1: 52,845,069 probably benign Het
Hmcn1 A T 1: 150,743,788 C1192S probably damaging Het
Hsd11b1 CGG CG 1: 193,240,249 probably null Het
Ifi214 A G 1: 173,525,120 Y248H probably damaging Het
Igf2bp2 T G 16: 22,089,085 I89L probably damaging Het
Il2ra A T 2: 11,676,892 T103S possibly damaging Het
Ino80 T A 2: 119,445,575 M407L probably benign Het
Jade1 A C 3: 41,613,511 K671N probably benign Het
Lca5 C T 9: 83,398,595 S384N probably benign Het
Lce1l G T 3: 92,850,497 P18H unknown Het
Lrrc8d T C 5: 105,797,670 probably benign Het
Ly75 T C 2: 60,365,145 N223S probably damaging Het
Ncf4 T G 15: 78,260,788 probably benign Het
Ncoa1 T A 12: 4,253,746 M1362L probably benign Het
Olfr1 T C 11: 73,395,177 T282A probably benign Het
Olfr467 A G 7: 107,815,244 Y220C probably benign Het
Olfr765 G C 10: 129,046,564 F166L probably damaging Het
Prkg2 T C 5: 98,967,734 R543G probably damaging Het
Ptprd A C 4: 76,059,667 probably null Het
Scap A G 9: 110,381,429 S969G possibly damaging Het
Sgk2 T C 2: 162,994,704 F60S probably benign Het
Sgpp1 G T 12: 75,735,207 Y119* probably null Het
Siglech A T 7: 55,768,665 K31* probably null Het
Slc40a1 A G 1: 45,912,338 Y220H probably damaging Het
Smurf2 G A 11: 106,852,563 T219M possibly damaging Het
Speer4f2 A G 5: 17,376,528 K156R possibly damaging Het
Spp1 T G 5: 104,440,558 D276E probably benign Het
Stk32b T C 5: 37,459,734 probably null Het
Stxbp5 G A 10: 9,762,924 Q1044* probably null Het
Sv2c T A 13: 95,961,378 T696S probably damaging Het
Tubgcp2 A C 7: 140,005,024 probably null Het
Ubap1l C T 9: 65,371,691 P91S probably damaging Het
Vmn2r76 A T 7: 86,225,449 D773E probably damaging Het
Xirp2 C G 2: 67,515,302 S2629C probably benign Het
Zbtb20 C A 16: 43,610,867 C580* probably null Het
Zfp957 T A 14: 79,213,182 Q392H unknown Het
Zfyve19 C T 2: 119,211,946 T178M probably damaging Het
Zswim6 T C 13: 107,769,593 noncoding transcript Het
Other mutations in Mcm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Mcm3 APN 1 20804815 critical splice donor site probably null
IGL01061:Mcm3 APN 1 20814496 missense possibly damaging 0.86
IGL01488:Mcm3 APN 1 20813056 missense possibly damaging 0.90
IGL01609:Mcm3 APN 1 20814680 splice site probably benign
IGL02483:Mcm3 APN 1 20803572 missense possibly damaging 0.68
IGL02869:Mcm3 APN 1 20808839 missense probably damaging 0.99
R0197:Mcm3 UTSW 1 20810105 missense probably damaging 1.00
R0462:Mcm3 UTSW 1 20805332 missense probably benign
R0467:Mcm3 UTSW 1 20804847 missense probably benign
R0669:Mcm3 UTSW 1 20804929 intron probably null
R1251:Mcm3 UTSW 1 20812672 nonsense probably null
R1599:Mcm3 UTSW 1 20820198 missense probably benign 0.08
R1764:Mcm3 UTSW 1 20805879 missense probably damaging 0.98
R2015:Mcm3 UTSW 1 20803580 missense probably damaging 0.98
R2140:Mcm3 UTSW 1 20813110 missense probably benign 0.00
R3033:Mcm3 UTSW 1 20808768 missense probably damaging 1.00
R4430:Mcm3 UTSW 1 20811993 nonsense probably null
R4513:Mcm3 UTSW 1 20810232 missense probably damaging 1.00
R4563:Mcm3 UTSW 1 20809645 missense probably benign
R4713:Mcm3 UTSW 1 20803577 missense probably benign
R4801:Mcm3 UTSW 1 20810156 missense probably damaging 0.99
R4802:Mcm3 UTSW 1 20810156 missense probably damaging 0.99
R4896:Mcm3 UTSW 1 20820256 utr 5 prime probably benign
R5035:Mcm3 UTSW 1 20803418 utr 3 prime probably benign
R5461:Mcm3 UTSW 1 20814437 missense probably benign 0.00
R5486:Mcm3 UTSW 1 20814894 missense probably damaging 1.00
R5759:Mcm3 UTSW 1 20808748 frame shift probably null
R5760:Mcm3 UTSW 1 20808748 frame shift probably null
R6505:Mcm3 UTSW 1 20803544 missense probably damaging 1.00
R6833:Mcm3 UTSW 1 20810096 missense possibly damaging 0.48
R6834:Mcm3 UTSW 1 20810096 missense possibly damaging 0.48
X0062:Mcm3 UTSW 1 20820137 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CCTGATCGTCTCACCATCAG -3'
(R):5'- AGGCTTGTCTTAGCTGCAGG -3'

Sequencing Primer
(F):5'- GATCGTCTCACCATCAGCTTCC -3'
(R):5'- TCCTCAGTGCTGGTATCAGACG -3'
Posted On2016-10-06