Incidental Mutation 'R5531:Hibch'
ID433668
Institutional Source Beutler Lab
Gene Symbol Hibch
Ensembl Gene ENSMUSG00000041426
Gene Name3-hydroxyisobutyryl-Coenzyme A hydrolase
Synonyms2610509I15Rik, HIBYL-COA-H
MMRRC Submission 043089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R5531 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location52844929-52920986 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 52845069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044478] [ENSMUST00000159352]
Predicted Effect probably benign
Transcript: ENSMUST00000044478
SMART Domains Protein: ENSMUSP00000045606
Gene: ENSMUSG00000041426

DomainStartEndE-ValueType
Pfam:ECH_1 43 282 6.6e-34 PFAM
Pfam:ECH_2 45 375 3.9e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159352
SMART Domains Protein: ENSMUSP00000124976
Gene: ENSMUSG00000041426

DomainStartEndE-ValueType
Pfam:ECH 44 299 1.3e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186922
Meta Mutation Damage Score 0.0572 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for hydrolysis of both HIBYL-CoA and beta-hydroxypropionyl-CoA. Mutations in this gene have been associated with 3-hyroxyisobutyryl-CoA hydrolase deficiency. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,753,672 S647P possibly damaging Het
Acacb T C 5: 114,204,706 F878L possibly damaging Het
Acr T A 15: 89,573,943 Y276N probably damaging Het
AI987944 A T 7: 41,374,390 Y388* probably null Het
Ankrd29 G A 18: 12,279,778 T114I probably damaging Het
Ap5z1 T C 5: 142,467,781 M168T probably benign Het
Bard1 A C 1: 71,046,721 C608W probably damaging Het
Clspn A G 4: 126,577,773 R907G probably benign Het
Cubn C T 2: 13,350,932 V1830I probably benign Het
Cwc22 T C 2: 77,924,569 N221S probably damaging Het
Dact3 A G 7: 16,875,615 E64G possibly damaging Het
Dhx40 T C 11: 86,789,504 E381G possibly damaging Het
Dnah7a A G 1: 53,419,748 S3744P possibly damaging Het
Epha4 A G 1: 77,374,876 V914A probably benign Het
Fbxw10 G A 11: 62,862,656 C492Y probably damaging Het
G930045G22Rik C A 6: 50,847,776 noncoding transcript Het
Gm21103 A T 14: 6,303,861 I63K probably damaging Het
Gpr156 T C 16: 38,005,257 V612A probably benign Het
Gucy2g A G 19: 55,241,140 S33P probably benign Het
Hmcn1 A T 1: 150,743,788 C1192S probably damaging Het
Hsd11b1 CGG CG 1: 193,240,249 probably null Het
Ifi214 A G 1: 173,525,120 Y248H probably damaging Het
Igf2bp2 T G 16: 22,089,085 I89L probably damaging Het
Il2ra A T 2: 11,676,892 T103S possibly damaging Het
Ino80 T A 2: 119,445,575 M407L probably benign Het
Jade1 A C 3: 41,613,511 K671N probably benign Het
Lca5 C T 9: 83,398,595 S384N probably benign Het
Lce1l G T 3: 92,850,497 P18H unknown Het
Lrrc8d T C 5: 105,797,670 probably benign Het
Ly75 T C 2: 60,365,145 N223S probably damaging Het
Mcm3 A T 1: 20,803,544 F784Y possibly damaging Het
Ncf4 T G 15: 78,260,788 probably benign Het
Ncoa1 T A 12: 4,253,746 M1362L probably benign Het
Olfr1 T C 11: 73,395,177 T282A probably benign Het
Olfr467 A G 7: 107,815,244 Y220C probably benign Het
Olfr765 G C 10: 129,046,564 F166L probably damaging Het
Prkg2 T C 5: 98,967,734 R543G probably damaging Het
Ptprd A C 4: 76,059,667 probably null Het
Scap A G 9: 110,381,429 S969G possibly damaging Het
Sgk2 T C 2: 162,994,704 F60S probably benign Het
Sgpp1 G T 12: 75,735,207 Y119* probably null Het
Siglech A T 7: 55,768,665 K31* probably null Het
Slc40a1 A G 1: 45,912,338 Y220H probably damaging Het
Smurf2 G A 11: 106,852,563 T219M possibly damaging Het
Speer4f2 A G 5: 17,376,528 K156R possibly damaging Het
Spp1 T G 5: 104,440,558 D276E probably benign Het
Stk32b T C 5: 37,459,734 probably null Het
Stxbp5 G A 10: 9,762,924 Q1044* probably null Het
Sv2c T A 13: 95,961,378 T696S probably damaging Het
Tubgcp2 A C 7: 140,005,024 probably null Het
Ubap1l C T 9: 65,371,691 P91S probably damaging Het
Vmn2r76 A T 7: 86,225,449 D773E probably damaging Het
Xirp2 C G 2: 67,515,302 S2629C probably benign Het
Zbtb20 C A 16: 43,610,867 C580* probably null Het
Zfp957 T A 14: 79,213,182 Q392H unknown Het
Zfyve19 C T 2: 119,211,946 T178M probably damaging Het
Zswim6 T C 13: 107,769,593 noncoding transcript Het
Other mutations in Hibch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Hibch APN 1 52885190 splice site probably benign
IGL00722:Hibch APN 1 52901320 missense probably damaging 0.96
IGL03130:Hibch APN 1 52885151 missense possibly damaging 0.88
IGL03327:Hibch APN 1 52920380 unclassified probably benign
IGL03346:Hibch APN 1 52920380 unclassified probably benign
R0033:Hibch UTSW 1 52905451 missense probably null 0.60
R0033:Hibch UTSW 1 52905451 missense probably null 0.60
R0494:Hibch UTSW 1 52902896 missense possibly damaging 0.73
R1853:Hibch UTSW 1 52901335 critical splice donor site probably null
R4838:Hibch UTSW 1 52885178 missense possibly damaging 0.55
R5239:Hibch UTSW 1 52865608 missense probably damaging 1.00
R5583:Hibch UTSW 1 52901247 missense probably damaging 1.00
R5809:Hibch UTSW 1 52853700 missense probably benign 0.16
R6246:Hibch UTSW 1 52904642 missense probably damaging 0.99
R6365:Hibch UTSW 1 52868937 synonymous probably null
Predicted Primers PCR Primer
(F):5'- TAGTTAACGCCCCTAGCCAG -3'
(R):5'- TACAAAGGCGACTAGATCTGC -3'

Sequencing Primer
(F):5'- CTGTCTAGTGTGGCCCTGC -3'
(R):5'- ACTAGATCTGCGAGACCTGC -3'
Posted On2016-10-06