Incidental Mutation 'R5531:Ino80'
ID433681
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission 043089-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R5531 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119445575 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 407 (M407L)
Ref Sequence ENSEMBL: ENSMUSP00000106431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]
Predicted Effect probably benign
Transcript: ENSMUST00000049920
AA Change: M407L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: M407L

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110808
AA Change: M407L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: M407L

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 272 412 8.8e-55 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
PDB:3MWY|W 1098 1136 6e-7 PDB
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,753,672 S647P possibly damaging Het
Acacb T C 5: 114,204,706 F878L possibly damaging Het
Acr T A 15: 89,573,943 Y276N probably damaging Het
AI987944 A T 7: 41,374,390 Y388* probably null Het
Ankrd29 G A 18: 12,279,778 T114I probably damaging Het
Ap5z1 T C 5: 142,467,781 M168T probably benign Het
Bard1 A C 1: 71,046,721 C608W probably damaging Het
Clspn A G 4: 126,577,773 R907G probably benign Het
Cubn C T 2: 13,350,932 V1830I probably benign Het
Cwc22 T C 2: 77,924,569 N221S probably damaging Het
Dact3 A G 7: 16,875,615 E64G possibly damaging Het
Dhx40 T C 11: 86,789,504 E381G possibly damaging Het
Dnah7a A G 1: 53,419,748 S3744P possibly damaging Het
Epha4 A G 1: 77,374,876 V914A probably benign Het
Fbxw10 G A 11: 62,862,656 C492Y probably damaging Het
G930045G22Rik C A 6: 50,847,776 noncoding transcript Het
Gm21103 A T 14: 6,303,861 I63K probably damaging Het
Gpr156 T C 16: 38,005,257 V612A probably benign Het
Gucy2g A G 19: 55,241,140 S33P probably benign Het
Hibch A G 1: 52,845,069 probably benign Het
Hmcn1 A T 1: 150,743,788 C1192S probably damaging Het
Hsd11b1 CGG CG 1: 193,240,249 probably null Het
Ifi214 A G 1: 173,525,120 Y248H probably damaging Het
Igf2bp2 T G 16: 22,089,085 I89L probably damaging Het
Il2ra A T 2: 11,676,892 T103S possibly damaging Het
Jade1 A C 3: 41,613,511 K671N probably benign Het
Lca5 C T 9: 83,398,595 S384N probably benign Het
Lce1l G T 3: 92,850,497 P18H unknown Het
Lrrc8d T C 5: 105,797,670 probably benign Het
Ly75 T C 2: 60,365,145 N223S probably damaging Het
Mcm3 A T 1: 20,803,544 F784Y possibly damaging Het
Ncf4 T G 15: 78,260,788 probably benign Het
Ncoa1 T A 12: 4,253,746 M1362L probably benign Het
Olfr1 T C 11: 73,395,177 T282A probably benign Het
Olfr467 A G 7: 107,815,244 Y220C probably benign Het
Olfr765 G C 10: 129,046,564 F166L probably damaging Het
Prkg2 T C 5: 98,967,734 R543G probably damaging Het
Ptprd A C 4: 76,059,667 probably null Het
Scap A G 9: 110,381,429 S969G possibly damaging Het
Sgk2 T C 2: 162,994,704 F60S probably benign Het
Sgpp1 G T 12: 75,735,207 Y119* probably null Het
Siglech A T 7: 55,768,665 K31* probably null Het
Slc40a1 A G 1: 45,912,338 Y220H probably damaging Het
Smurf2 G A 11: 106,852,563 T219M possibly damaging Het
Speer4f2 A G 5: 17,376,528 K156R possibly damaging Het
Spp1 T G 5: 104,440,558 D276E probably benign Het
Stk32b T C 5: 37,459,734 probably null Het
Stxbp5 G A 10: 9,762,924 Q1044* probably null Het
Sv2c T A 13: 95,961,378 T696S probably damaging Het
Tubgcp2 A C 7: 140,005,024 probably null Het
Ubap1l C T 9: 65,371,691 P91S probably damaging Het
Vmn2r76 A T 7: 86,225,449 D773E probably damaging Het
Xirp2 C G 2: 67,515,302 S2629C probably benign Het
Zbtb20 C A 16: 43,610,867 C580* probably null Het
Zfp957 T A 14: 79,213,182 Q392H unknown Het
Zfyve19 C T 2: 119,211,946 T178M probably damaging Het
Zswim6 T C 13: 107,769,593 noncoding transcript Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCACGAATTAGGACAAAACCTG -3'
(R):5'- GTTTTGAAGGACTTATACACAGGC -3'

Sequencing Primer
(F):5'- CTTCCTGACTCAGGACTT -3'
(R):5'- TACTTTAGGCCAAGAGGC -3'
Posted On2016-10-06