Incidental Mutation 'R5531:Dhx40'
ID433709
Institutional Source Beutler Lab
Gene Symbol Dhx40
Ensembl Gene ENSMUSG00000018425
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 40
SynonymsARG147, 2410016C14Rik, DDX40
MMRRC Submission 043089-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R5531 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86768846-86807746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86789504 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 381 (E381G)
Ref Sequence ENSEMBL: ENSMUSP00000018569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018569] [ENSMUST00000148263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018569
AA Change: E381G

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018569
Gene: ENSMUSG00000018425
AA Change: E381G

DomainStartEndE-ValueType
DEXDc 47 240 6.32e-33 SMART
HELICc 283 401 3.08e-13 SMART
HA2 462 557 1.92e-21 SMART
Pfam:OB_NTP_bind 588 699 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136977
Predicted Effect probably benign
Transcript: ENSMUST00000148263
AA Change: E144G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114918
Gene: ENSMUSG00000018425
AA Change: E144G

DomainStartEndE-ValueType
Blast:DEXDc 1 96 3e-60 BLAST
SCOP:d1a1va1 4 59 5e-7 SMART
HA2 164 259 1.92e-21 SMART
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DExH/D box family of ATP-dependent RNA helicases that have an essential role in RNA metabolism. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,753,672 S647P possibly damaging Het
Acacb T C 5: 114,204,706 F878L possibly damaging Het
Acr T A 15: 89,573,943 Y276N probably damaging Het
AI987944 A T 7: 41,374,390 Y388* probably null Het
Ankrd29 G A 18: 12,279,778 T114I probably damaging Het
Ap5z1 T C 5: 142,467,781 M168T probably benign Het
Bard1 A C 1: 71,046,721 C608W probably damaging Het
Clspn A G 4: 126,577,773 R907G probably benign Het
Cubn C T 2: 13,350,932 V1830I probably benign Het
Cwc22 T C 2: 77,924,569 N221S probably damaging Het
Dact3 A G 7: 16,875,615 E64G possibly damaging Het
Dnah7a A G 1: 53,419,748 S3744P possibly damaging Het
Epha4 A G 1: 77,374,876 V914A probably benign Het
Fbxw10 G A 11: 62,862,656 C492Y probably damaging Het
G930045G22Rik C A 6: 50,847,776 noncoding transcript Het
Gm21103 A T 14: 6,303,861 I63K probably damaging Het
Gpr156 T C 16: 38,005,257 V612A probably benign Het
Gucy2g A G 19: 55,241,140 S33P probably benign Het
Hibch A G 1: 52,845,069 probably benign Het
Hmcn1 A T 1: 150,743,788 C1192S probably damaging Het
Hsd11b1 CGG CG 1: 193,240,249 probably null Het
Ifi214 A G 1: 173,525,120 Y248H probably damaging Het
Igf2bp2 T G 16: 22,089,085 I89L probably damaging Het
Il2ra A T 2: 11,676,892 T103S possibly damaging Het
Ino80 T A 2: 119,445,575 M407L probably benign Het
Jade1 A C 3: 41,613,511 K671N probably benign Het
Lca5 C T 9: 83,398,595 S384N probably benign Het
Lce1l G T 3: 92,850,497 P18H unknown Het
Lrrc8d T C 5: 105,797,670 probably benign Het
Ly75 T C 2: 60,365,145 N223S probably damaging Het
Mcm3 A T 1: 20,803,544 F784Y possibly damaging Het
Ncf4 T G 15: 78,260,788 probably benign Het
Ncoa1 T A 12: 4,253,746 M1362L probably benign Het
Olfr1 T C 11: 73,395,177 T282A probably benign Het
Olfr467 A G 7: 107,815,244 Y220C probably benign Het
Olfr765 G C 10: 129,046,564 F166L probably damaging Het
Prkg2 T C 5: 98,967,734 R543G probably damaging Het
Ptprd A C 4: 76,059,667 probably null Het
Scap A G 9: 110,381,429 S969G possibly damaging Het
Sgk2 T C 2: 162,994,704 F60S probably benign Het
Sgpp1 G T 12: 75,735,207 Y119* probably null Het
Siglech A T 7: 55,768,665 K31* probably null Het
Slc40a1 A G 1: 45,912,338 Y220H probably damaging Het
Smurf2 G A 11: 106,852,563 T219M possibly damaging Het
Speer4f2 A G 5: 17,376,528 K156R possibly damaging Het
Spp1 T G 5: 104,440,558 D276E probably benign Het
Stk32b T C 5: 37,459,734 probably null Het
Stxbp5 G A 10: 9,762,924 Q1044* probably null Het
Sv2c T A 13: 95,961,378 T696S probably damaging Het
Tubgcp2 A C 7: 140,005,024 probably null Het
Ubap1l C T 9: 65,371,691 P91S probably damaging Het
Vmn2r76 A T 7: 86,225,449 D773E probably damaging Het
Xirp2 C G 2: 67,515,302 S2629C probably benign Het
Zbtb20 C A 16: 43,610,867 C580* probably null Het
Zfp957 T A 14: 79,213,182 Q392H unknown Het
Zfyve19 C T 2: 119,211,946 T178M probably damaging Het
Zswim6 T C 13: 107,769,593 noncoding transcript Het
Other mutations in Dhx40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Dhx40 APN 11 86776702 missense probably damaging 0.98
IGL02818:Dhx40 APN 11 86799505 missense probably benign 0.26
IGL02932:Dhx40 APN 11 86771929 missense probably damaging 1.00
R0312:Dhx40 UTSW 11 86771949 missense probably damaging 0.99
R0485:Dhx40 UTSW 11 86771262 unclassified probably benign
R0542:Dhx40 UTSW 11 86804256 critical splice donor site probably null
R0565:Dhx40 UTSW 11 86771167 missense probably damaging 0.97
R1218:Dhx40 UTSW 11 86799484 missense probably benign 0.13
R1406:Dhx40 UTSW 11 86797745 missense probably benign 0.01
R1406:Dhx40 UTSW 11 86797745 missense probably benign 0.01
R1544:Dhx40 UTSW 11 86806553 missense possibly damaging 0.93
R1550:Dhx40 UTSW 11 86776739 splice site probably null
R1839:Dhx40 UTSW 11 86789297 missense possibly damaging 0.46
R2923:Dhx40 UTSW 11 86789263 missense probably benign 0.26
R3743:Dhx40 UTSW 11 86771159 missense probably damaging 0.99
R3864:Dhx40 UTSW 11 86789245 missense possibly damaging 0.85
R4902:Dhx40 UTSW 11 86771210 missense possibly damaging 0.95
R4918:Dhx40 UTSW 11 86804391 missense possibly damaging 0.85
R5119:Dhx40 UTSW 11 86776636 missense probably damaging 0.99
R5416:Dhx40 UTSW 11 86797691 missense probably benign 0.01
R5677:Dhx40 UTSW 11 86800963 splice site probably null
R6270:Dhx40 UTSW 11 86799605 missense possibly damaging 0.85
R6431:Dhx40 UTSW 11 86773823 missense probably damaging 0.97
R6456:Dhx40 UTSW 11 86784974 missense probably damaging 1.00
R6594:Dhx40 UTSW 11 86785773 missense possibly damaging 0.74
R6599:Dhx40 UTSW 11 86804349 missense possibly damaging 0.51
R7069:Dhx40 UTSW 11 86797743 missense probably benign 0.06
X0021:Dhx40 UTSW 11 86773814 missense possibly damaging 0.84
X0066:Dhx40 UTSW 11 86806502 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCACTGCGTTGTAATGCTTC -3'
(R):5'- TCGGCTGTGTATGAGGAATC -3'

Sequencing Primer
(F):5'- TGCTTCACTTCTACAAAAGACAG -3'
(R):5'- CTTAGTGGCTAAGAGCACTGC -3'
Posted On2016-10-06