Incidental Mutation 'R5531:Acr'
ID433717
Institutional Source Beutler Lab
Gene Symbol Acr
Ensembl Gene ENSMUSG00000022622
Gene Nameacrosin prepropeptide
Synonymspreproacrosin
MMRRC Submission 043089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5531 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89568326-89574585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89573943 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 276 (Y276N)
Ref Sequence ENSEMBL: ENSMUSP00000023295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023295]
Predicted Effect probably damaging
Transcript: ENSMUST00000023295
AA Change: Y276N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023295
Gene: ENSMUSG00000022622
AA Change: Y276N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 42 286 6.84e-91 SMART
low complexity region 300 311 N/A INTRINSIC
low complexity region 329 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230538
Predicted Effect probably benign
Transcript: ENSMUST00000230978
Predicted Effect probably benign
Transcript: ENSMUST00000231216
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for a targeted null mutation produce sperm that shows delayed fertilization in vitro. Sperm from mutant gonial cells are ineffective at fertilization in competition with normal sperm both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,753,672 S647P possibly damaging Het
Acacb T C 5: 114,204,706 F878L possibly damaging Het
AI987944 A T 7: 41,374,390 Y388* probably null Het
Ankrd29 G A 18: 12,279,778 T114I probably damaging Het
Ap5z1 T C 5: 142,467,781 M168T probably benign Het
Bard1 A C 1: 71,046,721 C608W probably damaging Het
Clspn A G 4: 126,577,773 R907G probably benign Het
Cubn C T 2: 13,350,932 V1830I probably benign Het
Cwc22 T C 2: 77,924,569 N221S probably damaging Het
Dact3 A G 7: 16,875,615 E64G possibly damaging Het
Dhx40 T C 11: 86,789,504 E381G possibly damaging Het
Dnah7a A G 1: 53,419,748 S3744P possibly damaging Het
Epha4 A G 1: 77,374,876 V914A probably benign Het
Fbxw10 G A 11: 62,862,656 C492Y probably damaging Het
G930045G22Rik C A 6: 50,847,776 noncoding transcript Het
Gm21103 A T 14: 6,303,861 I63K probably damaging Het
Gpr156 T C 16: 38,005,257 V612A probably benign Het
Gucy2g A G 19: 55,241,140 S33P probably benign Het
Hibch A G 1: 52,845,069 probably benign Het
Hmcn1 A T 1: 150,743,788 C1192S probably damaging Het
Hsd11b1 CGG CG 1: 193,240,249 probably null Het
Ifi214 A G 1: 173,525,120 Y248H probably damaging Het
Igf2bp2 T G 16: 22,089,085 I89L probably damaging Het
Il2ra A T 2: 11,676,892 T103S possibly damaging Het
Ino80 T A 2: 119,445,575 M407L probably benign Het
Jade1 A C 3: 41,613,511 K671N probably benign Het
Lca5 C T 9: 83,398,595 S384N probably benign Het
Lce1l G T 3: 92,850,497 P18H unknown Het
Lrrc8d T C 5: 105,797,670 probably benign Het
Ly75 T C 2: 60,365,145 N223S probably damaging Het
Mcm3 A T 1: 20,803,544 F784Y possibly damaging Het
Ncf4 T G 15: 78,260,788 probably benign Het
Ncoa1 T A 12: 4,253,746 M1362L probably benign Het
Olfr1 T C 11: 73,395,177 T282A probably benign Het
Olfr467 A G 7: 107,815,244 Y220C probably benign Het
Olfr765 G C 10: 129,046,564 F166L probably damaging Het
Prkg2 T C 5: 98,967,734 R543G probably damaging Het
Ptprd A C 4: 76,059,667 probably null Het
Scap A G 9: 110,381,429 S969G possibly damaging Het
Sgk2 T C 2: 162,994,704 F60S probably benign Het
Sgpp1 G T 12: 75,735,207 Y119* probably null Het
Siglech A T 7: 55,768,665 K31* probably null Het
Slc40a1 A G 1: 45,912,338 Y220H probably damaging Het
Smurf2 G A 11: 106,852,563 T219M possibly damaging Het
Speer4f2 A G 5: 17,376,528 K156R possibly damaging Het
Spp1 T G 5: 104,440,558 D276E probably benign Het
Stk32b T C 5: 37,459,734 probably null Het
Stxbp5 G A 10: 9,762,924 Q1044* probably null Het
Sv2c T A 13: 95,961,378 T696S probably damaging Het
Tubgcp2 A C 7: 140,005,024 probably null Het
Ubap1l C T 9: 65,371,691 P91S probably damaging Het
Vmn2r76 A T 7: 86,225,449 D773E probably damaging Het
Xirp2 C G 2: 67,515,302 S2629C probably benign Het
Zbtb20 C A 16: 43,610,867 C580* probably null Het
Zfp957 T A 14: 79,213,182 Q392H unknown Het
Zfyve19 C T 2: 119,211,946 T178M probably damaging Het
Zswim6 T C 13: 107,769,593 noncoding transcript Het
Other mutations in Acr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Acr APN 15 89573250 missense probably benign 0.19
IGL00857:Acr APN 15 89570002 missense probably benign 0.00
IGL01353:Acr APN 15 89569492 missense probably damaging 1.00
IGL01466:Acr APN 15 89573994 missense probably benign
IGL01599:Acr APN 15 89568414 missense probably benign 0.01
IGL02408:Acr APN 15 89570014 missense probably damaging 1.00
R0042:Acr UTSW 15 89574332 missense probably benign
R0398:Acr UTSW 15 89573941 missense probably damaging 1.00
R0520:Acr UTSW 15 89573227 missense probably damaging 1.00
R0578:Acr UTSW 15 89569475 missense probably damaging 1.00
R0579:Acr UTSW 15 89569475 missense probably damaging 1.00
R1167:Acr UTSW 15 89573974 missense probably damaging 1.00
R1792:Acr UTSW 15 89573143 missense probably benign 0.00
R2006:Acr UTSW 15 89574201 missense probably benign 0.00
R5577:Acr UTSW 15 89574238 missense probably benign 0.01
R7033:Acr UTSW 15 89569500 missense probably benign 0.03
R7206:Acr UTSW 15 89574171 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTACAGACATTTGTTCTCC -3'
(R):5'- GTAGTGGTCGCAGGTAAAGC -3'

Sequencing Primer
(F):5'- CCCATCCATGAGTCTTCTGGGAAG -3'
(R):5'- CGGTCGAGAAGGCAGGTG -3'
Posted On2016-10-06