Incidental Mutation 'R5533:Nebl'
ID433731
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Namenebulette
SynonymsLnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
MMRRC Submission 043091-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R5533 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location17343909-17731464 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 17393268 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 414 (Y414*)
Ref Sequence ENSEMBL: ENSMUSP00000122024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000131957] [ENSMUST00000132418] [ENSMUST00000145492] [ENSMUST00000177966]
Predicted Effect probably benign
Transcript: ENSMUST00000028080
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124270
AA Change: Y486*
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: Y486*

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124611
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127912
Predicted Effect probably null
Transcript: ENSMUST00000131957
AA Change: Y451*
SMART Domains Protein: ENSMUSP00000118525
Gene: ENSMUSG00000053702
AA Change: Y451*

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
NEBU 427 457 4.92e-6 SMART
NEBU 464 494 2.33e-7 SMART
NEBU 501 525 1.02e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000132418
AA Change: Y414*
SMART Domains Protein: ENSMUSP00000122024
Gene: ENSMUSG00000053702
AA Change: Y414*

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 4.78e-4 SMART
NEBU 427 450 6.81e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137253
Predicted Effect probably benign
Transcript: ENSMUST00000145492
SMART Domains Protein: ENSMUSP00000121313
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150194
Predicted Effect probably benign
Transcript: ENSMUST00000177966
SMART Domains Protein: ENSMUSP00000137567
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 5 35 2.23e-4 SMART
NEBU 36 66 3.28e-2 SMART
NEBU 67 97 6.6e-7 SMART
NEBU 98 120 2e1 SMART
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,083,042 E429G unknown Het
Akap12 T A 10: 4,357,405 V1405D probably damaging Het
Akap7 C T 10: 25,283,982 D107N possibly damaging Het
Arfgef1 A G 1: 10,199,727 probably null Het
Cacna1s T A 1: 136,098,375 probably null Het
Casc4 AGATGGTGATGGTG AGATGGTG 2: 121,925,697 probably benign Het
Ctsd T C 7: 142,377,333 Q274R probably benign Het
Dysf G A 6: 84,186,471 R1575Q probably damaging Het
Erich6b A T 14: 75,658,834 L53F possibly damaging Het
Exoc6 A C 19: 37,593,770 probably null Het
Fbxw19 A T 9: 109,486,065 V143E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fndc1 A G 17: 7,772,776 F696S unknown Het
Foxa3 G T 7: 19,015,015 Y102* probably null Het
Foxn1 A G 11: 78,365,966 M301T probably damaging Het
Foxp2 C T 6: 15,197,120 Q54* probably null Het
Glra1 T C 11: 55,532,382 E117G possibly damaging Het
Glt1d1 A T 5: 127,691,031 D234V probably damaging Het
Gm597 T A 1: 28,778,082 I290F probably damaging Het
Gulp1 T C 1: 44,773,281 I137T probably damaging Het
Itga8 A G 2: 12,160,350 V816A possibly damaging Het
Kdm4c G A 4: 74,315,649 probably benign Het
Krtap19-2 A G 16: 88,874,108 probably benign Het
Lcorl T C 5: 45,733,877 N378S possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mocos T C 18: 24,674,300 L363P probably damaging Het
Mycbp2 G T 14: 103,282,645 Y745* probably null Het
Nav3 A C 10: 109,883,678 N141K possibly damaging Het
Ncor1 T C 11: 62,343,011 N779S probably benign Het
Nf1 T G 11: 79,445,789 C1065G probably damaging Het
Nfib A G 4: 82,359,767 V216A probably damaging Het
Nub1 A T 5: 24,702,381 N354I possibly damaging Het
Nyap1 C T 5: 137,735,464 V436I probably benign Het
Olfr1029 A G 2: 85,975,453 D70G possibly damaging Het
Olfr498 T C 7: 108,466,262 F313L probably benign Het
Pde2a T A 7: 101,505,980 M570K probably damaging Het
Pfas T C 11: 68,991,470 S856G probably benign Het
Pkd1l2 T C 8: 117,068,116 E368G probably benign Het
Ptf1a G A 2: 19,447,158 V323M probably damaging Het
Ptprh T C 7: 4,549,505 Y920C probably damaging Het
Sergef T A 7: 46,614,776 D229V possibly damaging Het
Slc1a4 T C 11: 20,304,417 K483R probably benign Het
Slc26a6 G A 9: 108,857,956 R351H probably damaging Het
Slc6a19 G A 13: 73,685,829 T370I possibly damaging Het
Smpd5 T C 15: 76,294,557 S42P possibly damaging Het
Snx13 G A 12: 35,123,026 probably null Het
Sox10 G A 15: 79,156,302 S185L probably benign Het
Srpk1 T C 17: 28,602,759 Y227C probably damaging Het
Stambpl1 T A 19: 34,233,916 probably null Het
Stk36 A G 1: 74,626,591 R698G possibly damaging Het
Tas2r122 T A 6: 132,711,430 T167S probably damaging Het
Tlr12 A G 4: 128,615,863 S865P probably damaging Het
Trp53bp1 A G 2: 121,207,746 L1537P probably damaging Het
Vstm2a C A 11: 16,263,125 T170K possibly damaging Het
Xpo7 A T 14: 70,693,967 F304I probably damaging Het
Zfp286 T C 11: 62,780,970 probably benign Het
Zfp985 A T 4: 147,582,983 K103* probably null Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0128:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2062:Nebl UTSW 2 17397121 missense probably benign 0.39
R2183:Nebl UTSW 2 17404216 missense probably damaging 0.99
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2679:Nebl UTSW 2 17424591 missense probably benign 0.03
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R2878:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 unclassified probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5597:Nebl UTSW 2 17378167 missense probably benign
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGGTCCTATTGTTATTCATG -3'
(R):5'- TTAGTACACAAAGCCTCCTGG -3'

Sequencing Primer
(F):5'- CATGTGTTTCAACAACAAGGTGAC -3'
(R):5'- GTACACAAAGCCTCCTGGTTATG -3'
Posted On2016-10-06