Incidental Mutation 'R5533:Nyap1'
ID433743
Institutional Source Beutler Lab
Gene Symbol Nyap1
Ensembl Gene ENSMUSG00000045348
Gene Nameneuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms6430598A04Rik, Nyap1
MMRRC Submission 043091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5533 (G1)
Quality Score115
Status Not validated
Chromosome5
Chromosomal Location137729899-137741607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137735464 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 436 (V436I)
Ref Sequence ENSEMBL: ENSMUSP00000114694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061789] [ENSMUST00000118326] [ENSMUST00000149512] [ENSMUST00000212152]
Predicted Effect probably benign
Transcript: ENSMUST00000061789
AA Change: V436I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058217
Gene: ENSMUSG00000045348
AA Change: V436I

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118326
AA Change: V436I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113397
Gene: ENSMUSG00000045348
AA Change: V436I

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149512
AA Change: V436I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114694
Gene: ENSMUSG00000045348
AA Change: V436I

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 7.1e-128 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 771 1.9e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212152
AA Change: V436I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,083,042 E429G unknown Het
Akap12 T A 10: 4,357,405 V1405D probably damaging Het
Akap7 C T 10: 25,283,982 D107N possibly damaging Het
Arfgef1 A G 1: 10,199,727 probably null Het
Cacna1s T A 1: 136,098,375 probably null Het
Casc4 AGATGGTGATGGTG AGATGGTG 2: 121,925,697 probably benign Het
Ctsd T C 7: 142,377,333 Q274R probably benign Het
Dysf G A 6: 84,186,471 R1575Q probably damaging Het
Erich6b A T 14: 75,658,834 L53F possibly damaging Het
Exoc6 A C 19: 37,593,770 probably null Het
Fbxw19 A T 9: 109,486,065 V143E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fndc1 A G 17: 7,772,776 F696S unknown Het
Foxa3 G T 7: 19,015,015 Y102* probably null Het
Foxn1 A G 11: 78,365,966 M301T probably damaging Het
Foxp2 C T 6: 15,197,120 Q54* probably null Het
Glra1 T C 11: 55,532,382 E117G possibly damaging Het
Glt1d1 A T 5: 127,691,031 D234V probably damaging Het
Gm597 T A 1: 28,778,082 I290F probably damaging Het
Gulp1 T C 1: 44,773,281 I137T probably damaging Het
Itga8 A G 2: 12,160,350 V816A possibly damaging Het
Kdm4c G A 4: 74,315,649 probably benign Het
Krtap19-2 A G 16: 88,874,108 probably benign Het
Lcorl T C 5: 45,733,877 N378S possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mocos T C 18: 24,674,300 L363P probably damaging Het
Mycbp2 G T 14: 103,282,645 Y745* probably null Het
Nav3 A C 10: 109,883,678 N141K possibly damaging Het
Ncor1 T C 11: 62,343,011 N779S probably benign Het
Nebl G T 2: 17,393,268 Y414* probably null Het
Nf1 T G 11: 79,445,789 C1065G probably damaging Het
Nfib A G 4: 82,359,767 V216A probably damaging Het
Nub1 A T 5: 24,702,381 N354I possibly damaging Het
Olfr1029 A G 2: 85,975,453 D70G possibly damaging Het
Olfr498 T C 7: 108,466,262 F313L probably benign Het
Pde2a T A 7: 101,505,980 M570K probably damaging Het
Pfas T C 11: 68,991,470 S856G probably benign Het
Pkd1l2 T C 8: 117,068,116 E368G probably benign Het
Ptf1a G A 2: 19,447,158 V323M probably damaging Het
Ptprh T C 7: 4,549,505 Y920C probably damaging Het
Sergef T A 7: 46,614,776 D229V possibly damaging Het
Slc1a4 T C 11: 20,304,417 K483R probably benign Het
Slc26a6 G A 9: 108,857,956 R351H probably damaging Het
Slc6a19 G A 13: 73,685,829 T370I possibly damaging Het
Smpd5 T C 15: 76,294,557 S42P possibly damaging Het
Snx13 G A 12: 35,123,026 probably null Het
Sox10 G A 15: 79,156,302 S185L probably benign Het
Srpk1 T C 17: 28,602,759 Y227C probably damaging Het
Stambpl1 T A 19: 34,233,916 probably null Het
Stk36 A G 1: 74,626,591 R698G possibly damaging Het
Tas2r122 T A 6: 132,711,430 T167S probably damaging Het
Tlr12 A G 4: 128,615,863 S865P probably damaging Het
Trp53bp1 A G 2: 121,207,746 L1537P probably damaging Het
Vstm2a C A 11: 16,263,125 T170K possibly damaging Het
Xpo7 A T 14: 70,693,967 F304I probably damaging Het
Zfp286 T C 11: 62,780,970 probably benign Het
Zfp985 A T 4: 147,582,983 K103* probably null Het
Other mutations in Nyap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Nyap1 APN 5 137738084 missense probably damaging 1.00
IGL02211:Nyap1 APN 5 137739675 missense probably damaging 0.99
IGL02658:Nyap1 APN 5 137735484 missense probably damaging 0.99
IGL03493:Nyap1 APN 5 137735016 missense probably damaging 1.00
R0180:Nyap1 UTSW 5 137738021 missense probably damaging 1.00
R0731:Nyap1 UTSW 5 137735298 missense probably damaging 1.00
R1215:Nyap1 UTSW 5 137735133 nonsense probably null
R1741:Nyap1 UTSW 5 137733125 missense probably damaging 1.00
R1953:Nyap1 UTSW 5 137735032 missense probably benign 0.01
R2006:Nyap1 UTSW 5 137735691 missense possibly damaging 0.81
R2131:Nyap1 UTSW 5 137733681 intron probably null
R2244:Nyap1 UTSW 5 137735314 missense probably damaging 1.00
R4581:Nyap1 UTSW 5 137736022 missense probably damaging 1.00
R4857:Nyap1 UTSW 5 137735578 missense probably damaging 0.98
R5151:Nyap1 UTSW 5 137736114 missense probably damaging 0.99
R5695:Nyap1 UTSW 5 137734984 missense probably damaging 1.00
R7201:Nyap1 UTSW 5 137736262 missense probably damaging 1.00
R7210:Nyap1 UTSW 5 137737982 missense probably damaging 1.00
R7374:Nyap1 UTSW 5 137735529 missense probably damaging 1.00
R7434:Nyap1 UTSW 5 137736268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCCATGAAGTACTGAAATCTCC -3'
(R):5'- TGATGGGGTCTCAAGGCTAC -3'

Sequencing Primer
(F):5'- CATGAAGTACTGAAATCTCCTCTGTC -3'
(R):5'- TCAAGGCTACCGGTCCTCTG -3'
Posted On2016-10-06