Incidental Mutation 'R5533:Foxp2'
ID433744
Institutional Source Beutler Lab
Gene Symbol Foxp2
Ensembl Gene ENSMUSG00000029563
Gene Nameforkhead box P2
SynonymsD0Kist7, 2810043D05Rik
MMRRC Submission 043091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5533 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location14901349-15441977 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 15197120 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 54 (Q54*)
Ref Sequence ENSEMBL: ENSMUSP00000121503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031545] [ENSMUST00000115469] [ENSMUST00000115470] [ENSMUST00000115472] [ENSMUST00000115474] [ENSMUST00000115477] [ENSMUST00000128567] [ENSMUST00000131414] [ENSMUST00000137628] [ENSMUST00000140557] [ENSMUST00000154448]
Predicted Effect probably null
Transcript: ENSMUST00000031545
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000031545
Gene: ENSMUSG00000029563
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 140 215 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
ZnF_C2H2 345 370 3.02e0 SMART
low complexity region 437 458 N/A INTRINSIC
FH 501 582 7.5e-37 SMART
low complexity region 605 624 N/A INTRINSIC
low complexity region 697 714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115469
AA Change: Q53*
SMART Domains Protein: ENSMUSP00000111129
Gene: ENSMUSG00000029563
AA Change: Q53*

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 48 68 N/A INTRINSIC
coiled coil region 139 214 N/A INTRINSIC
low complexity region 290 303 N/A INTRINSIC
ZnF_C2H2 344 369 3.02e0 SMART
low complexity region 411 420 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115470
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000111130
Gene: ENSMUSG00000029563
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115472
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000111132
Gene: ENSMUSG00000029563
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 116 194 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
ZnF_C2H2 324 349 3.02e0 SMART
low complexity region 416 437 N/A INTRINSIC
FH 480 561 7.5e-37 SMART
low complexity region 584 603 N/A INTRINSIC
low complexity region 676 693 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115474
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000111134
Gene: ENSMUSG00000029563
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 165 240 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
ZnF_C2H2 370 395 3.02e0 SMART
low complexity region 462 483 N/A INTRINSIC
FH 526 607 7.5e-37 SMART
low complexity region 630 649 N/A INTRINSIC
low complexity region 722 739 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115477
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000111137
Gene: ENSMUSG00000029563
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 140 215 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
ZnF_C2H2 345 370 3.02e0 SMART
low complexity region 437 458 N/A INTRINSIC
FH 501 582 7.5e-37 SMART
low complexity region 605 624 N/A INTRINSIC
low complexity region 697 714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118133
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000113163
Gene: ENSMUSG00000029563
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128567
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000123067
Gene: ENSMUSG00000029563
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131414
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000123007
Gene: ENSMUSG00000029563
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 165 240 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
ZnF_C2H2 370 395 3.02e0 SMART
low complexity region 437 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137628
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000116650
Gene: ENSMUSG00000029563
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 95 N/A INTRINSIC
low complexity region 146 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138273
Predicted Effect probably null
Transcript: ENSMUST00000140557
AA Change: Q54*
SMART Domains Protein: ENSMUSP00000121503
Gene: ENSMUSG00000029563
AA Change: Q54*

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 95 133 N/A INTRINSIC
coiled coil region 146 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151301
SMART Domains Protein: ENSMUSP00000114735
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 48 68 N/A INTRINSIC
coiled coil region 139 214 N/A INTRINSIC
low complexity region 290 303 N/A INTRINSIC
Blast:ZnF_C2H2 344 363 8e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156883
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, growth retardation, reduced vocalization, prolonged external granule cell layer presence, abnormal Purkinje and radial glial cells, delayed eye opening and ear emergence, negative geotaxis, impaired righting response, and hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,083,042 E429G unknown Het
Akap12 T A 10: 4,357,405 V1405D probably damaging Het
Akap7 C T 10: 25,283,982 D107N possibly damaging Het
Arfgef1 A G 1: 10,199,727 probably null Het
Cacna1s T A 1: 136,098,375 probably null Het
Casc4 AGATGGTGATGGTG AGATGGTG 2: 121,925,697 probably benign Het
Ctsd T C 7: 142,377,333 Q274R probably benign Het
Dysf G A 6: 84,186,471 R1575Q probably damaging Het
Erich6b A T 14: 75,658,834 L53F possibly damaging Het
Exoc6 A C 19: 37,593,770 probably null Het
Fbxw19 A T 9: 109,486,065 V143E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fndc1 A G 17: 7,772,776 F696S unknown Het
Foxa3 G T 7: 19,015,015 Y102* probably null Het
Foxn1 A G 11: 78,365,966 M301T probably damaging Het
Glra1 T C 11: 55,532,382 E117G possibly damaging Het
Glt1d1 A T 5: 127,691,031 D234V probably damaging Het
Gm597 T A 1: 28,778,082 I290F probably damaging Het
Gulp1 T C 1: 44,773,281 I137T probably damaging Het
Itga8 A G 2: 12,160,350 V816A possibly damaging Het
Kdm4c G A 4: 74,315,649 probably benign Het
Krtap19-2 A G 16: 88,874,108 probably benign Het
Lcorl T C 5: 45,733,877 N378S possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mocos T C 18: 24,674,300 L363P probably damaging Het
Mycbp2 G T 14: 103,282,645 Y745* probably null Het
Nav3 A C 10: 109,883,678 N141K possibly damaging Het
Ncor1 T C 11: 62,343,011 N779S probably benign Het
Nebl G T 2: 17,393,268 Y414* probably null Het
Nf1 T G 11: 79,445,789 C1065G probably damaging Het
Nfib A G 4: 82,359,767 V216A probably damaging Het
Nub1 A T 5: 24,702,381 N354I possibly damaging Het
Nyap1 C T 5: 137,735,464 V436I probably benign Het
Olfr1029 A G 2: 85,975,453 D70G possibly damaging Het
Olfr498 T C 7: 108,466,262 F313L probably benign Het
Pde2a T A 7: 101,505,980 M570K probably damaging Het
Pfas T C 11: 68,991,470 S856G probably benign Het
Pkd1l2 T C 8: 117,068,116 E368G probably benign Het
Ptf1a G A 2: 19,447,158 V323M probably damaging Het
Ptprh T C 7: 4,549,505 Y920C probably damaging Het
Sergef T A 7: 46,614,776 D229V possibly damaging Het
Slc1a4 T C 11: 20,304,417 K483R probably benign Het
Slc26a6 G A 9: 108,857,956 R351H probably damaging Het
Slc6a19 G A 13: 73,685,829 T370I possibly damaging Het
Smpd5 T C 15: 76,294,557 S42P possibly damaging Het
Snx13 G A 12: 35,123,026 probably null Het
Sox10 G A 15: 79,156,302 S185L probably benign Het
Srpk1 T C 17: 28,602,759 Y227C probably damaging Het
Stambpl1 T A 19: 34,233,916 probably null Het
Stk36 A G 1: 74,626,591 R698G possibly damaging Het
Tas2r122 T A 6: 132,711,430 T167S probably damaging Het
Tlr12 A G 4: 128,615,863 S865P probably damaging Het
Trp53bp1 A G 2: 121,207,746 L1537P probably damaging Het
Vstm2a C A 11: 16,263,125 T170K possibly damaging Het
Xpo7 A T 14: 70,693,967 F304I probably damaging Het
Zfp286 T C 11: 62,780,970 probably benign Het
Zfp985 A T 4: 147,582,983 K103* probably null Het
Other mutations in Foxp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Foxp2 APN 6 15403819 missense probably damaging 1.00
IGL01011:Foxp2 APN 6 15438019 makesense probably null
IGL01412:Foxp2 APN 6 15376758 intron probably benign
IGL01769:Foxp2 APN 6 15409835 missense possibly damaging 0.92
IGL02578:Foxp2 APN 6 15376815 intron probably benign
IGL03368:Foxp2 APN 6 15394718 missense probably damaging 1.00
R0004:Foxp2 UTSW 6 15197096 missense possibly damaging 0.68
R0081:Foxp2 UTSW 6 15405644 critical splice donor site probably benign
R0095:Foxp2 UTSW 6 15196977 missense probably damaging 1.00
R0233:Foxp2 UTSW 6 15409753 missense probably damaging 1.00
R0294:Foxp2 UTSW 6 15376774 intron probably benign
R0357:Foxp2 UTSW 6 15409840 missense probably damaging 0.99
R0432:Foxp2 UTSW 6 15254279 intron probably benign
R0659:Foxp2 UTSW 6 15254279 intron probably benign
R1381:Foxp2 UTSW 6 15409766 missense possibly damaging 0.50
R1813:Foxp2 UTSW 6 15379768 utr 3 prime probably benign
R1896:Foxp2 UTSW 6 15379768 utr 3 prime probably benign
R2007:Foxp2 UTSW 6 15396819 missense probably damaging 1.00
R2020:Foxp2 UTSW 6 15324644 missense possibly damaging 0.73
R2167:Foxp2 UTSW 6 15437902 missense probably damaging 1.00
R2326:Foxp2 UTSW 6 15409939 missense possibly damaging 0.84
R3829:Foxp2 UTSW 6 15379831 unclassified probably benign
R3978:Foxp2 UTSW 6 15197208 unclassified probably benign
R4393:Foxp2 UTSW 6 15377690 intron probably benign
R4703:Foxp2 UTSW 6 15411248 missense probably benign 0.03
R5202:Foxp2 UTSW 6 15394771 missense probably benign 0.05
R5303:Foxp2 UTSW 6 15324637 missense probably benign 0.00
R5368:Foxp2 UTSW 6 15377914 intron probably benign
R5655:Foxp2 UTSW 6 15197113 missense probably damaging 0.99
R6220:Foxp2 UTSW 6 15437948 missense probably damaging 1.00
R6241:Foxp2 UTSW 6 15394762 missense probably damaging 1.00
R6365:Foxp2 UTSW 6 15286685 missense probably damaging 1.00
R6384:Foxp2 UTSW 6 15437948 missense probably damaging 1.00
R7217:Foxp2 UTSW 6 15416024 missense unknown
X0023:Foxp2 UTSW 6 15409835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCTGAGAATGGAGGTGTG -3'
(R):5'- CACTCTGGCACTGCTATGAC -3'

Sequencing Primer
(F):5'- AGGTGTAACGTGTGTTAATTGATAC -3'
(R):5'- TGGCACTGCTATGACGTAAC -3'
Posted On2016-10-06