Incidental Mutation 'R5533:Olfr498'
ID433752
Institutional Source Beutler Lab
Gene Symbol Olfr498
Ensembl Gene ENSMUSG00000096679
Gene Nameolfactory receptor 498
SynonymsMOR204-36, GA_x6K02T2PBJ9-10795522-10796514
MMRRC Submission 043091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5533 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108465326-108467585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108466262 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 313 (F313L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000217616]
Predicted Effect probably benign
Transcript: ENSMUST00000074787
AA Change: F313L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000074343
Gene: ENSMUSG00000096679
AA Change: F313L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.7e-51 PFAM
Pfam:7tm_1 44 293 5.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217616
AA Change: F313L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,083,042 E429G unknown Het
Akap12 T A 10: 4,357,405 V1405D probably damaging Het
Akap7 C T 10: 25,283,982 D107N possibly damaging Het
Arfgef1 A G 1: 10,199,727 probably null Het
Cacna1s T A 1: 136,098,375 probably null Het
Casc4 AGATGGTGATGGTG AGATGGTG 2: 121,925,697 probably benign Het
Ctsd T C 7: 142,377,333 Q274R probably benign Het
Dysf G A 6: 84,186,471 R1575Q probably damaging Het
Erich6b A T 14: 75,658,834 L53F possibly damaging Het
Exoc6 A C 19: 37,593,770 probably null Het
Fbxw19 A T 9: 109,486,065 V143E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fndc1 A G 17: 7,772,776 F696S unknown Het
Foxa3 G T 7: 19,015,015 Y102* probably null Het
Foxn1 A G 11: 78,365,966 M301T probably damaging Het
Foxp2 C T 6: 15,197,120 Q54* probably null Het
Glra1 T C 11: 55,532,382 E117G possibly damaging Het
Glt1d1 A T 5: 127,691,031 D234V probably damaging Het
Gm597 T A 1: 28,778,082 I290F probably damaging Het
Gulp1 T C 1: 44,773,281 I137T probably damaging Het
Itga8 A G 2: 12,160,350 V816A possibly damaging Het
Kdm4c G A 4: 74,315,649 probably benign Het
Krtap19-2 A G 16: 88,874,108 probably benign Het
Lcorl T C 5: 45,733,877 N378S possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mocos T C 18: 24,674,300 L363P probably damaging Het
Mycbp2 G T 14: 103,282,645 Y745* probably null Het
Nav3 A C 10: 109,883,678 N141K possibly damaging Het
Ncor1 T C 11: 62,343,011 N779S probably benign Het
Nebl G T 2: 17,393,268 Y414* probably null Het
Nf1 T G 11: 79,445,789 C1065G probably damaging Het
Nfib A G 4: 82,359,767 V216A probably damaging Het
Nub1 A T 5: 24,702,381 N354I possibly damaging Het
Nyap1 C T 5: 137,735,464 V436I probably benign Het
Olfr1029 A G 2: 85,975,453 D70G possibly damaging Het
Pde2a T A 7: 101,505,980 M570K probably damaging Het
Pfas T C 11: 68,991,470 S856G probably benign Het
Pkd1l2 T C 8: 117,068,116 E368G probably benign Het
Ptf1a G A 2: 19,447,158 V323M probably damaging Het
Ptprh T C 7: 4,549,505 Y920C probably damaging Het
Sergef T A 7: 46,614,776 D229V possibly damaging Het
Slc1a4 T C 11: 20,304,417 K483R probably benign Het
Slc26a6 G A 9: 108,857,956 R351H probably damaging Het
Slc6a19 G A 13: 73,685,829 T370I possibly damaging Het
Smpd5 T C 15: 76,294,557 S42P possibly damaging Het
Snx13 G A 12: 35,123,026 probably null Het
Sox10 G A 15: 79,156,302 S185L probably benign Het
Srpk1 T C 17: 28,602,759 Y227C probably damaging Het
Stambpl1 T A 19: 34,233,916 probably null Het
Stk36 A G 1: 74,626,591 R698G possibly damaging Het
Tas2r122 T A 6: 132,711,430 T167S probably damaging Het
Tlr12 A G 4: 128,615,863 S865P probably damaging Het
Trp53bp1 A G 2: 121,207,746 L1537P probably damaging Het
Vstm2a C A 11: 16,263,125 T170K possibly damaging Het
Xpo7 A T 14: 70,693,967 F304I probably damaging Het
Zfp286 T C 11: 62,780,970 probably benign Het
Zfp985 A T 4: 147,582,983 K103* probably null Het
Other mutations in Olfr498
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03232:Olfr498 APN 7 108465605 missense probably benign 0.06
IGL03348:Olfr498 APN 7 108465408 missense probably benign
IGL03408:Olfr498 APN 7 108465347 missense probably damaging 1.00
IGL03047:Olfr498 UTSW 7 108465776 missense probably damaging 0.97
R0208:Olfr498 UTSW 7 108465543 missense probably damaging 1.00
R0363:Olfr498 UTSW 7 108465734 missense possibly damaging 0.81
R1481:Olfr498 UTSW 7 108465960 missense probably benign 0.00
R1886:Olfr498 UTSW 7 108465740 missense probably benign 0.39
R2065:Olfr498 UTSW 7 108465668 missense possibly damaging 0.69
R2103:Olfr498 UTSW 7 108465603 missense probably benign 0.03
R3731:Olfr498 UTSW 7 108465426 missense possibly damaging 0.88
R4763:Olfr498 UTSW 7 108466186 missense probably benign 0.34
R4839:Olfr498 UTSW 7 108465731 missense probably benign 0.03
R4997:Olfr498 UTSW 7 108465494 missense probably benign 0.01
R7286:Olfr498 UTSW 7 108465435 missense possibly damaging 0.52
Z1088:Olfr498 UTSW 7 108465371 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTGCAGTTATTCTGTTCTATGG -3'
(R):5'- GCTGCACATGATCAAAATACATTGC -3'

Sequencing Primer
(F):5'- GACCAGAACAAGGTGTTG -3'
(R):5'- GTATCTATGTGTACTGGGAGA -3'
Posted On2016-10-06