Incidental Mutation 'R5533:Akap7'
ID433759
Institutional Source Beutler Lab
Gene Symbol Akap7
Ensembl Gene ENSMUSG00000039166
Gene NameA kinase (PRKA) anchor protein 7
SynonymsAkap18, AKAP15
MMRRC Submission 043091-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5533 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location25169090-25307870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25283982 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 107 (D107N)
Ref Sequence ENSEMBL: ENSMUSP00000135137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041984] [ENSMUST00000095779] [ENSMUST00000176231] [ENSMUST00000176258] [ENSMUST00000177124]
Predicted Effect probably benign
Transcript: ENSMUST00000041984
AA Change: D34N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043624
Gene: ENSMUSG00000039166
AA Change: D34N

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
Pfam:AKAP7_NLS 51 249 2.1e-52 PFAM
Pfam:AKAP7_RIRII_bdg 255 312 1.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095779
AA Change: D34N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093455
Gene: ENSMUSG00000039166
AA Change: D34N

DomainStartEndE-ValueType
PDB:3J4R|A 1 63 6e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158423
Predicted Effect probably benign
Transcript: ENSMUST00000176231
Predicted Effect probably benign
Transcript: ENSMUST00000176258
AA Change: D34N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135037
Gene: ENSMUSG00000039166
AA Change: D34N

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
Pfam:AKAP7_NLS 51 142 5.3e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177124
AA Change: D107N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135137
Gene: ENSMUSG00000039166
AA Change: D107N

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
PDB:3J4R|A 37 126 1e-24 PDB
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the A-kinase anchoring protein (AKAP) family, a group of functionally related proteins that bind to a regulatory subunit (RII) of cAMP-dependent protein kinase A (PKA) and target the enzyme to specific subcellular compartments. AKAPs have a common RII-binding domain, but contain different targeting motifs responsible for directing PKA to distinct intracellular locations. Three alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show normal cardiomyocyte response to adrenergic stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,083,042 E429G unknown Het
Akap12 T A 10: 4,357,405 V1405D probably damaging Het
Arfgef1 A G 1: 10,199,727 probably null Het
Cacna1s T A 1: 136,098,375 probably null Het
Casc4 AGATGGTGATGGTG AGATGGTG 2: 121,925,697 probably benign Het
Ctsd T C 7: 142,377,333 Q274R probably benign Het
Dysf G A 6: 84,186,471 R1575Q probably damaging Het
Erich6b A T 14: 75,658,834 L53F possibly damaging Het
Exoc6 A C 19: 37,593,770 probably null Het
Fbxw19 A T 9: 109,486,065 V143E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fndc1 A G 17: 7,772,776 F696S unknown Het
Foxa3 G T 7: 19,015,015 Y102* probably null Het
Foxn1 A G 11: 78,365,966 M301T probably damaging Het
Foxp2 C T 6: 15,197,120 Q54* probably null Het
Glra1 T C 11: 55,532,382 E117G possibly damaging Het
Glt1d1 A T 5: 127,691,031 D234V probably damaging Het
Gm597 T A 1: 28,778,082 I290F probably damaging Het
Gulp1 T C 1: 44,773,281 I137T probably damaging Het
Itga8 A G 2: 12,160,350 V816A possibly damaging Het
Kdm4c G A 4: 74,315,649 probably benign Het
Krtap19-2 A G 16: 88,874,108 probably benign Het
Lcorl T C 5: 45,733,877 N378S possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mocos T C 18: 24,674,300 L363P probably damaging Het
Mycbp2 G T 14: 103,282,645 Y745* probably null Het
Nav3 A C 10: 109,883,678 N141K possibly damaging Het
Ncor1 T C 11: 62,343,011 N779S probably benign Het
Nebl G T 2: 17,393,268 Y414* probably null Het
Nf1 T G 11: 79,445,789 C1065G probably damaging Het
Nfib A G 4: 82,359,767 V216A probably damaging Het
Nub1 A T 5: 24,702,381 N354I possibly damaging Het
Nyap1 C T 5: 137,735,464 V436I probably benign Het
Olfr1029 A G 2: 85,975,453 D70G possibly damaging Het
Olfr498 T C 7: 108,466,262 F313L probably benign Het
Pde2a T A 7: 101,505,980 M570K probably damaging Het
Pfas T C 11: 68,991,470 S856G probably benign Het
Pkd1l2 T C 8: 117,068,116 E368G probably benign Het
Ptf1a G A 2: 19,447,158 V323M probably damaging Het
Ptprh T C 7: 4,549,505 Y920C probably damaging Het
Sergef T A 7: 46,614,776 D229V possibly damaging Het
Slc1a4 T C 11: 20,304,417 K483R probably benign Het
Slc26a6 G A 9: 108,857,956 R351H probably damaging Het
Slc6a19 G A 13: 73,685,829 T370I possibly damaging Het
Smpd5 T C 15: 76,294,557 S42P possibly damaging Het
Snx13 G A 12: 35,123,026 probably null Het
Sox10 G A 15: 79,156,302 S185L probably benign Het
Srpk1 T C 17: 28,602,759 Y227C probably damaging Het
Stambpl1 T A 19: 34,233,916 probably null Het
Stk36 A G 1: 74,626,591 R698G possibly damaging Het
Tas2r122 T A 6: 132,711,430 T167S probably damaging Het
Tlr12 A G 4: 128,615,863 S865P probably damaging Het
Trp53bp1 A G 2: 121,207,746 L1537P probably damaging Het
Vstm2a C A 11: 16,263,125 T170K possibly damaging Het
Xpo7 A T 14: 70,693,967 F304I probably damaging Het
Zfp286 T C 11: 62,780,970 probably benign Het
Zfp985 A T 4: 147,582,983 K103* probably null Het
Other mutations in Akap7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Akap7 APN 10 25171240 missense probably benign 0.00
IGL01638:Akap7 APN 10 25267425 missense probably damaging 1.00
IGL01920:Akap7 APN 10 25289603 nonsense probably null
IGL03145:Akap7 APN 10 25239667 missense probably damaging 1.00
ANU05:Akap7 UTSW 10 25271553 missense probably damaging 1.00
R0304:Akap7 UTSW 10 25271552 missense probably damaging 1.00
R1412:Akap7 UTSW 10 25289597 critical splice donor site probably null
R1791:Akap7 UTSW 10 25239685 missense probably benign
R2158:Akap7 UTSW 10 25171164 missense probably damaging 1.00
R5084:Akap7 UTSW 10 25279742 unclassified probably benign
R6222:Akap7 UTSW 10 25283946 nonsense probably null
R7195:Akap7 UTSW 10 25271507 missense probably damaging 0.97
R7261:Akap7 UTSW 10 25271518 missense possibly damaging 0.70
R7343:Akap7 UTSW 10 25289669 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCACAAAGCAAGTGAGCTG -3'
(R):5'- CCTTAAGGCACAAGTCTGTCTG -3'

Sequencing Primer
(F):5'- GTGAGCTGACAAGTAGGTAATATTC -3'
(R):5'- ATTGGGACACAGCTGTATCC -3'
Posted On2016-10-06