Incidental Mutation 'R5471:Vsx1'
ID433793
Institutional Source Beutler Lab
Gene Symbol Vsx1
Ensembl Gene ENSMUSG00000033080
Gene Namevisual system homeobox 1
SynonymsCHX10-like
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.504) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150680702-150689360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150683066 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 343 (T343A)
Ref Sequence ENSEMBL: ENSMUSP00000039088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046095]
Predicted Effect probably benign
Transcript: ENSMUST00000046095
AA Change: T343A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039088
Gene: ENSMUSG00000033080
AA Change: T343A

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 99 116 N/A INTRINSIC
HOX 171 233 1.63e-26 SMART
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a paired-like homeodomain and binds to the core of the locus control region of the red/green visual pigment gene cluster. The encoded protein may regulate expression of the cone opsin genes early in development. Mutations in this gene can cause posterior polymorphous corneal dystrophy and keratoconus. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this locus impairs cone bipolar cell differentiation and affects retinal electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Vsx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Vsx1 APN 2 150688527 missense probably benign
IGL02216:Vsx1 APN 2 150684575 missense possibly damaging 0.95
IGL03089:Vsx1 APN 2 150685590 splice site probably benign
R1725:Vsx1 UTSW 2 150686200 missense probably benign 0.41
R4619:Vsx1 UTSW 2 150688609 missense probably benign
R5956:Vsx1 UTSW 2 150688537 missense possibly damaging 0.61
R6499:Vsx1 UTSW 2 150688521 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGTATGAATGTTCCCCACTCTAG -3'
(R):5'- TCCACAGGGATGAGAAAACC -3'

Sequencing Primer
(F):5'- TGTTCCCCACTCTAGAACTAAAGGG -3'
(R):5'- CCAGAAAGTGAAGACAAGTTGGC -3'
Posted On2016-10-06