Incidental Mutation 'R5472:Lrsam1'
ID433850
Institutional Source Beutler Lab
Gene Symbol Lrsam1
Ensembl Gene ENSMUSG00000026792
Gene Nameleucine rich repeat and sterile alpha motif containing 1
Synonyms
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5472 (G1)
Quality Score116
Status Not validated
Chromosome2
Chromosomal Location32925216-32961614 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ACC to AC at 32945858 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028132] [ENSMUST00000113200]
Predicted Effect probably null
Transcript: ENSMUST00000028132
SMART Domains Protein: ENSMUSP00000028132
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113200
SMART Domains Protein: ENSMUSP00000108825
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195713
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ring finger protein involved in a variety of functions, including regulation of signaling pathways and cell adhesion, mediation of self-ubiquitylation, and involvement in cargo sorting during receptor endocytosis. Mutations in this gene have been associated with Charcot-Marie-Tooth disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mutant mice either heterozygous or homozygous for a gene trapped allele exhibit mild neuromuscular junction and axonal defects in the absence of a neuronal challenge, but show increased sensitivity to acrylamide-induced motor axon degeneration relative to control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Lrsam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Lrsam1 APN 2 32955173 splice site probably benign
IGL01407:Lrsam1 APN 2 32947903 missense probably damaging 0.99
IGL01565:Lrsam1 APN 2 32936495 missense probably damaging 1.00
IGL01985:Lrsam1 APN 2 32928091 missense probably benign
IGL02743:Lrsam1 APN 2 32928649 splice site probably null
R0240:Lrsam1 UTSW 2 32955185 missense probably damaging 1.00
R0591:Lrsam1 UTSW 2 32933923 splice site probably benign
R0845:Lrsam1 UTSW 2 32953443 missense possibly damaging 0.94
R0945:Lrsam1 UTSW 2 32947909 missense probably benign 0.04
R1475:Lrsam1 UTSW 2 32954265 missense possibly damaging 0.48
R2147:Lrsam1 UTSW 2 32945879 missense probably damaging 1.00
R3790:Lrsam1 UTSW 2 32958159 missense probably null 1.00
R4374:Lrsam1 UTSW 2 32955191 missense possibly damaging 0.79
R4822:Lrsam1 UTSW 2 32926792 missense probably damaging 0.99
R5014:Lrsam1 UTSW 2 32936395 intron probably benign
R5566:Lrsam1 UTSW 2 32941858 missense probably damaging 1.00
R5640:Lrsam1 UTSW 2 32945852 missense probably benign 0.13
R5992:Lrsam1 UTSW 2 32955222 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCAGGTTCCTTTGTGACC -3'
(R):5'- GTTCTCCCTGAGGATTGCAG -3'

Sequencing Primer
(F):5'- AGGTTCCTTTGTGACCTGGGG -3'
(R):5'- ATTGCAGCTCCTCAGAAGCTG -3'
Posted On2016-10-06