Incidental Mutation 'R5472:Prpf8'
ID433880
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Namepre-mRNA processing factor 8
SynonymsSfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75486816-75509449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 75503643 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1801 (K1801N)
Ref Sequence ENSEMBL: ENSMUSP00000099568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018449
AA Change: K1801N

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: K1801N

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102510
AA Change: K1801N

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: K1801N

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75495646 missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75490406 missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75495744 missense probably benign 0.32
IGL01946:Prpf8 APN 11 75499992 missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75501834 nonsense probably null
IGL02077:Prpf8 APN 11 75495809 missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75490672 missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75509258 missense probably benign 0.32
cutter UTSW 11 75495426 splice site probably null
PIT4514001:Prpf8 UTSW 11 75496355 missense possibly damaging 0.53
R0254:Prpf8 UTSW 11 75506362 missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75505249 missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75501942 splice site probably benign
R0573:Prpf8 UTSW 11 75490654 missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75503444 missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75493949 missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75494430 missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75508674 unclassified probably benign
R1123:Prpf8 UTSW 11 75495285 missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75490330 missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75495423 critical splice donor site probably null
R1901:Prpf8 UTSW 11 75504744 missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75496511 missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75487721 missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75490531 missense probably benign
R2185:Prpf8 UTSW 11 75487113 nonsense probably null
R2271:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75496034 missense probably benign 0.00
R3744:Prpf8 UTSW 11 75506721 unclassified probably null
R3893:Prpf8 UTSW 11 75500257 missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75490702 missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75492505 missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75509228 unclassified probably null
R5186:Prpf8 UTSW 11 75489783 missense possibly damaging 0.93
R5215:Prpf8 UTSW 11 75500204 missense probably benign 0.02
R5288:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75506410 missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75508958 missense probably damaging 1.00
R5539:Prpf8 UTSW 11 75503638 missense probably benign 0.20
R5620:Prpf8 UTSW 11 75505101 missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75504738 missense probably damaging 1.00
R5887:Prpf8 UTSW 11 75500908 missense possibly damaging 0.87
R5948:Prpf8 UTSW 11 75509189 missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75494022 critical splice donor site probably null
R6250:Prpf8 UTSW 11 75493508 missense possibly damaging 0.95
R6358:Prpf8 UTSW 11 75491495 missense probably benign 0.33
R6629:Prpf8 UTSW 11 75495426 splice site probably null
R6804:Prpf8 UTSW 11 75499809 missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75490736 missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75504828 missense possibly damaging 0.72
R7038:Prpf8 UTSW 11 75496158 missense probably benign 0.02
R7089:Prpf8 UTSW 11 75508548 missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75490400 missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75503355 nonsense probably null
R7182:Prpf8 UTSW 11 75490727 missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75493957 missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75491784 missense probably benign 0.32
X0028:Prpf8 UTSW 11 75506764 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTGAACTCTTCTCTAACCAG -3'
(R):5'- GAGGCTGGCTTCAAACTTGC -3'

Sequencing Primer
(F):5'- CAGATTATCTGGTTTGTGGATGACAC -3'
(R):5'- GCTGGCTTCAAACTTGCAAAGATC -3'
Posted On2016-10-06