Incidental Mutation 'R5472:Akap11'
ID433891
Institutional Source Beutler Lab
Gene Symbol Akap11
Ensembl Gene ENSMUSG00000022016
Gene NameA kinase (PRKA) anchor protein 11
Synonyms6330501D17Rik
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location78492246-78536808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78513429 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 506 (N506S)
Ref Sequence ENSEMBL: ENSMUSP00000116015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022593] [ENSMUST00000123853]
Predicted Effect probably benign
Transcript: ENSMUST00000022593
AA Change: N506S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022593
Gene: ENSMUSG00000022016
AA Change: N506S

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1738 1755 N/A INTRINSIC
low complexity region 1767 1788 N/A INTRINSIC
Blast:AKAP_110 1790 1883 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123853
AA Change: N506S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116015
Gene: ENSMUSG00000022016
AA Change: N506S

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1731 1756 N/A INTRINSIC
low complexity region 1768 1789 N/A INTRINSIC
Blast:AKAP_110 1791 1884 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227722
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed at high levels throughout spermatogenesis and in mature sperm. It binds the RI and RII subunits of PKA in testis. It may serve a function in cell cycle control of both somatic cells and germ cells in addition to its putative role in spermatogenesis and sperm function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduction in body size, body length and tibia length, hypoactivity, slow movement and increased anxiety-related responses, and exhibit actin barrier defects in kidney collecting duct cells and increased urine osmolality in response to overhydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Akap11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Akap11 APN 14 78511341 missense probably damaging 1.00
IGL00902:Akap11 APN 14 78495838 missense probably benign 0.11
IGL01752:Akap11 APN 14 78509878 critical splice donor site probably null
IGL01972:Akap11 APN 14 78507857 missense probably damaging 0.99
IGL02031:Akap11 APN 14 78513813 missense possibly damaging 0.50
IGL02239:Akap11 APN 14 78513849 missense probably damaging 1.00
IGL02528:Akap11 APN 14 78510867 missense probably damaging 1.00
IGL02884:Akap11 APN 14 78498962 missense probably benign 0.02
IGL03130:Akap11 APN 14 78510368 nonsense probably null
IGL03179:Akap11 APN 14 78507740 missense probably benign 0.00
IGL03240:Akap11 APN 14 78495905 missense probably damaging 0.99
IGL03331:Akap11 APN 14 78513865 missense probably damaging 1.00
bonham UTSW 14 78498864 nonsense probably null
R0004:Akap11 UTSW 14 78514940 missense possibly damaging 0.65
R0020:Akap11 UTSW 14 78518177 missense probably benign 0.37
R0200:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0281:Akap11 UTSW 14 78510089 missense possibly damaging 0.84
R0320:Akap11 UTSW 14 78513379 missense probably benign
R0381:Akap11 UTSW 14 78513550 missense probably benign 0.01
R0536:Akap11 UTSW 14 78514024 missense probably damaging 1.00
R0608:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0735:Akap11 UTSW 14 78510078 missense probably damaging 1.00
R1189:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1400:Akap11 UTSW 14 78513962 missense probably damaging 1.00
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1501:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1588:Akap11 UTSW 14 78510245 missense possibly damaging 0.50
R1717:Akap11 UTSW 14 78513348 missense probably benign 0.02
R1823:Akap11 UTSW 14 78511488 missense probably damaging 1.00
R1847:Akap11 UTSW 14 78513661 missense probably benign 0.00
R1874:Akap11 UTSW 14 78511866 missense probably benign 0.14
R2031:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2032:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2276:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2763:Akap11 UTSW 14 78518892 missense probably damaging 0.98
R4483:Akap11 UTSW 14 78510259 missense probably damaging 1.00
R4582:Akap11 UTSW 14 78511929 missense possibly damaging 0.81
R4857:Akap11 UTSW 14 78498860 missense probably damaging 0.99
R4922:Akap11 UTSW 14 78512780 nonsense probably null
R4993:Akap11 UTSW 14 78512968 missense probably damaging 1.00
R5426:Akap11 UTSW 14 78498864 nonsense probably null
R5683:Akap11 UTSW 14 78512578 missense probably damaging 0.98
R5774:Akap11 UTSW 14 78510967 missense probably damaging 1.00
R6014:Akap11 UTSW 14 78512499 missense probably benign 0.00
R6264:Akap11 UTSW 14 78512421 missense possibly damaging 0.68
R6270:Akap11 UTSW 14 78518799 missense probably damaging 1.00
R6319:Akap11 UTSW 14 78513538 missense probably benign 0.06
R6376:Akap11 UTSW 14 78514896 missense probably damaging 1.00
R6394:Akap11 UTSW 14 78522589 critical splice donor site probably null
R6536:Akap11 UTSW 14 78511314 missense possibly damaging 0.81
R7048:Akap11 UTSW 14 78512514 missense
R7147:Akap11 UTSW 14 78511465 missense
Predicted Primers PCR Primer
(F):5'- TTGACAGCTAAGTGGCATAAGG -3'
(R):5'- CAGCCCTATTCGAACCTCAG -3'

Sequencing Primer
(F):5'- GGTATTGGTACATGAAGAAACTCC -3'
(R):5'- AGCTTTTAGTCCTCCTGGAAG -3'
Posted On2016-10-06