Incidental Mutation 'R5473:Olfr218'
ID433904
Institutional Source Beutler Lab
Gene Symbol Olfr218
Ensembl Gene ENSMUSG00000046643
Gene Nameolfactory receptor 218
SynonymsOlfr1405-ps1, GA_x6K02T2R7CC-643715-642847, GA_x6K02SYWG4P-534-1100, MOR267-3, MOR267-3
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5473 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173197808-173206336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 173204165 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 270 (G270R)
Ref Sequence ENSEMBL: ENSMUSP00000150815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057548] [ENSMUST00000215844] [ENSMUST00000216603]
Predicted Effect probably benign
Transcript: ENSMUST00000057548
AA Change: G270R

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000053317
Gene: ENSMUSG00000046643
AA Change: G270R

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.4e-58 PFAM
Pfam:7tm_1 42 291 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215844
AA Change: G270R

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216603
AA Change: G270R

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Olfr218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03404:Olfr218 APN 1 173204199 missense probably benign 0.08
R0265:Olfr218 UTSW 1 173203917 missense probably benign 0.10
R1388:Olfr218 UTSW 1 173203878 missense probably benign 0.01
R1463:Olfr218 UTSW 1 173203367 missense probably benign
R1547:Olfr218 UTSW 1 173203672 nonsense probably null
R1698:Olfr218 UTSW 1 173203371 missense probably damaging 1.00
R1892:Olfr218 UTSW 1 173204228 missense probably damaging 1.00
R4773:Olfr218 UTSW 1 173204229 missense probably damaging 1.00
R4939:Olfr218 UTSW 1 173203463 missense possibly damaging 0.95
R6149:Olfr218 UTSW 1 173204015 missense probably benign 0.15
R6582:Olfr218 UTSW 1 173204280 missense probably benign 0.00
R7151:Olfr218 UTSW 1 173204066 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGGCCTGCACAGATACC -3'
(R):5'- CACTTGCATGCATATAAAGGCAC -3'

Sequencing Primer
(F):5'- ATCAACTTTATTGTCAGCGTGTG -3'
(R):5'- GCATGCATATAAAGGCACTAAAATG -3'
Posted On2016-10-06