Incidental Mutation 'R5473:Crat'
ID433906
Institutional Source Beutler Lab
Gene Symbol Crat
Ensembl Gene ENSMUSG00000026853
Gene Namecarnitine acetyltransferase
SynonymsCARAT
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R5473 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30400471-30415813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30407714 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 266 (L266P)
Ref Sequence ENSEMBL: ENSMUSP00000099919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028207] [ENSMUST00000102854] [ENSMUST00000102855] [ENSMUST00000132981] [ENSMUST00000154595] [ENSMUST00000156702]
Predicted Effect probably damaging
Transcript: ENSMUST00000028207
AA Change: L266P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028207
Gene: ENSMUSG00000026853
AA Change: L266P

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 616 1.9e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102854
AA Change: L245P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099918
Gene: ENSMUSG00000026853
AA Change: L245P

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 13 595 1.8e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102855
AA Change: L266P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099919
Gene: ENSMUSG00000026853
AA Change: L266P

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 35 615 2.4e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132981
SMART Domains Protein: ENSMUSP00000118507
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 76 2.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146603
Predicted Effect probably benign
Transcript: ENSMUST00000154595
SMART Domains Protein: ENSMUSP00000114925
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 1 132 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155790
SMART Domains Protein: ENSMUSP00000122814
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 1 133 2.4e-51 PFAM
Pfam:Carn_acyltransf 128 190 8.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156702
Meta Mutation Damage Score 0.538 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes carnitine O-acetyltransferase, a member of the carnitine acyltransferase family and a key metabolic pathway enzyme which plays an important role in energy homeostasis and fat metabolism. This enzyme catalyzes the reversible transfer of acyl groups from an acyl-CoA thioester to carnitine and regulates the ratio of acyl-CoA/CoA. It is found in both the mitochondria and the peroxisome. Alternative splicing results in transcript variants encoding different isoforms that may localize to different subcellular compartments. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice with muscle specific loss of function display increased circulating glucose level, impaired glucose tolerance, insulin resistance, decreased circulating triglyceride and free fatty acid levels, increased susceptibility to diet-induced obesity and abnormal mitochondrial physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Crat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Crat APN 2 30405187 missense probably damaging 0.99
IGL01357:Crat APN 2 30407724 missense probably damaging 1.00
IGL01538:Crat APN 2 30409966 missense probably damaging 1.00
IGL01973:Crat APN 2 30405481 missense probably damaging 0.98
IGL02228:Crat APN 2 30413182 missense probably damaging 1.00
IGL02408:Crat APN 2 30407134 missense probably damaging 1.00
IGL02569:Crat APN 2 30404530 missense probably damaging 0.99
IGL02637:Crat APN 2 30406389 missense probably benign 0.06
IGL02983:Crat APN 2 30404526 critical splice donor site probably null
IGL03395:Crat APN 2 30404966 missense probably benign 0.11
Charlie UTSW 2 30403541 missense probably damaging 1.00
veruca UTSW 2 30403628 unclassified probably benign
R0136:Crat UTSW 2 30407030 missense probably benign
R0389:Crat UTSW 2 30403628 unclassified probably benign
R0443:Crat UTSW 2 30403628 unclassified probably benign
R0619:Crat UTSW 2 30409984 missense probably benign 0.14
R1938:Crat UTSW 2 30413061 missense probably benign
R1990:Crat UTSW 2 30405048 missense possibly damaging 0.93
R2113:Crat UTSW 2 30402642 missense probably benign 0.00
R2655:Crat UTSW 2 30402691 missense probably damaging 1.00
R3150:Crat UTSW 2 30413859 critical splice donor site probably null
R4231:Crat UTSW 2 30413011 missense possibly damaging 0.95
R4553:Crat UTSW 2 30408217 missense probably benign 0.00
R4592:Crat UTSW 2 30415366 utr 5 prime probably benign
R4718:Crat UTSW 2 30408164 nonsense probably null
R4808:Crat UTSW 2 30410021 missense probably benign 0.01
R4982:Crat UTSW 2 30407136 critical splice acceptor site probably null
R6049:Crat UTSW 2 30403541 missense probably damaging 1.00
R6223:Crat UTSW 2 30407030 missense probably benign 0.07
R6774:Crat UTSW 2 30413183 missense probably damaging 1.00
R6885:Crat UTSW 2 30415196 splice site probably benign
R7376:Crat UTSW 2 30406465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCCAATATAGGGTTTGATG -3'
(R):5'- CACAGTTCTTCGAGCTGGATG -3'

Sequencing Primer
(F):5'- CAACTTGCTACTTCACAGGGAGG -3'
(R):5'- CTTCGAGCTGGATGTGTACCAC -3'
Posted On2016-10-06