Incidental Mutation 'R5473:Camk2d'
ID433915
Institutional Source Beutler Lab
Gene Symbol Camk2d
Ensembl Gene ENSMUSG00000053819
Gene Namecalcium/calmodulin-dependent protein kinase II, delta
SynonymsCaMK II, 2810011D23Rik, 8030469K03Rik
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R5473 (G1)
Quality Score184
Status Validated
Chromosome3
Chromosomal Location126596302-126846326 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) G to T at 126597399 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066466] [ENSMUST00000106399] [ENSMUST00000106400] [ENSMUST00000106401] [ENSMUST00000106402] [ENSMUST00000134466] [ENSMUST00000145454] [ENSMUST00000163226] [ENSMUST00000171289] [ENSMUST00000199300] [ENSMUST00000200171]
Predicted Effect probably benign
Transcript: ENSMUST00000066466
SMART Domains Protein: ENSMUSP00000063359
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 7.4e-67 PFAM
Pfam:DUF4440 350 464 4.7e-13 PFAM
Pfam:SnoaL_3 350 476 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106399
SMART Domains Protein: ENSMUSP00000102007
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 357 484 3.5e-67 PFAM
Pfam:DUF4440 361 475 5.4e-13 PFAM
Pfam:SnoaL_3 361 487 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106400
SMART Domains Protein: ENSMUSP00000102008
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 4.7e-67 PFAM
Pfam:DUF4440 350 464 3.2e-13 PFAM
Pfam:SnoaL_3 350 476 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106401
SMART Domains Protein: ENSMUSP00000102009
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.8e-67 PFAM
Pfam:DUF4440 384 498 5.8e-13 PFAM
Pfam:SnoaL_3 384 510 3.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106402
SMART Domains Protein: ENSMUSP00000102010
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 1.1e-66 PFAM
Pfam:DUF4440 384 498 8.1e-13 PFAM
Pfam:SnoaL_3 384 510 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131869
SMART Domains Protein: ENSMUSP00000126412
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 1 109 5.1e-26 PFAM
Pfam:Pkinase_Tyr 3 111 4.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134466
SMART Domains Protein: ENSMUSP00000114801
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1e-33 PFAM
Pfam:Pkinase_Tyr 14 141 4.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143383
Predicted Effect probably benign
Transcript: ENSMUST00000145454
SMART Domains Protein: ENSMUSP00000130769
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1.4e-33 PFAM
Pfam:Pkinase_Tyr 14 142 4.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149311
Predicted Effect probably benign
Transcript: ENSMUST00000163226
SMART Domains Protein: ENSMUSP00000133019
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169051
SMART Domains Protein: ENSMUSP00000132554
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 6.9e-67 PFAM
Pfam:DUF4440 350 464 4.3e-13 PFAM
Pfam:SnoaL_3 350 476 2.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171289
SMART Domains Protein: ENSMUSP00000129999
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.3e-63 PFAM
Pfam:DUF4440 384 498 3.2e-12 PFAM
Pfam:SnoaL_3 384 509 8.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197897
Predicted Effect probably benign
Transcript: ENSMUST00000199300
SMART Domains Protein: ENSMUSP00000143504
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 1.3e-62 PFAM
Pfam:DUF4440 350 464 1.7e-11 PFAM
Pfam:SnoaL_3 350 475 4.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200171
SMART Domains Protein: ENSMUSP00000143677
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 9.8e-63 PFAM
Pfam:DUF4440 384 498 2.5e-11 PFAM
Pfam:SnoaL_3 384 509 5.7e-11 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced response to heart induced stress. Mice homozygous for an allele that produces an oxidant-resistant product exhibit reduced response to myocardial infarction in a diabetic model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Camk2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Camk2d APN 3 126838272 nonsense probably null
IGL01113:Camk2d APN 3 126780412 missense probably damaging 1.00
IGL01125:Camk2d APN 3 126798285 splice site probably benign
IGL01912:Camk2d APN 3 126810632 splice site probably null
IGL01934:Camk2d APN 3 126834655 splice site probably null
IGL02184:Camk2d APN 3 126797773 missense probably damaging 0.97
IGL02218:Camk2d APN 3 126840153 missense probably benign 0.00
IGL02804:Camk2d APN 3 126797738 missense possibly damaging 0.53
IGL03347:Camk2d APN 3 126796901 missense probably damaging 1.00
IGL03354:Camk2d APN 3 126796966 splice site probably null
baryon UTSW 3 126597482 nonsense probably null
neutron UTSW 3 126780420 missense probably damaging 1.00
R0024:Camk2d UTSW 3 126797723 missense probably benign 0.01
R0024:Camk2d UTSW 3 126797723 missense probably benign 0.01
R0628:Camk2d UTSW 3 126810624 splice site probably benign
R1114:Camk2d UTSW 3 126840292 missense probably damaging 1.00
R1433:Camk2d UTSW 3 126808224 missense probably benign 0.25
R2021:Camk2d UTSW 3 126780456 missense probably damaging 1.00
R2096:Camk2d UTSW 3 126780442 missense probably damaging 1.00
R2098:Camk2d UTSW 3 126780442 missense probably damaging 1.00
R2421:Camk2d UTSW 3 126780415 missense probably damaging 1.00
R2437:Camk2d UTSW 3 126834628 missense probably damaging 1.00
R2930:Camk2d UTSW 3 126808231 missense possibly damaging 0.86
R3738:Camk2d UTSW 3 126771839 missense probably damaging 1.00
R3969:Camk2d UTSW 3 126796959 missense possibly damaging 0.81
R4455:Camk2d UTSW 3 126780403 missense probably damaging 1.00
R4829:Camk2d UTSW 3 126779997 intron probably benign
R4916:Camk2d UTSW 3 126783975 missense probably damaging 1.00
R5277:Camk2d UTSW 3 126684741 intron probably benign
R5329:Camk2d UTSW 3 126597482 nonsense probably null
R5364:Camk2d UTSW 3 126780420 missense probably damaging 1.00
R5509:Camk2d UTSW 3 126840316 missense probably damaging 1.00
R5958:Camk2d UTSW 3 126779865 intron probably benign
R6010:Camk2d UTSW 3 126797714 missense possibly damaging 0.83
R6145:Camk2d UTSW 3 126805858 missense probably benign
R7267:Camk2d UTSW 3 126797730 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- ACTGCGACATCTCAGTCCC -3'
(R):5'- AGGCTCTCTATCCCCACGAG -3'

Sequencing Primer
(F):5'- TGTTCACTCGGCCGCTG -3'
(R):5'- CCACGAGGGAGACGAGG -3'
Posted On2016-10-06