Incidental Mutation 'R5473:Pramef8'
ID433918
Institutional Source Beutler Lab
Gene Symbol Pramef8
Ensembl Gene ENSMUSG00000046862
Gene NamePRAME family member 8
Synonyms4732496O08Rik
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5473 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143412426-143421091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143419304 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 448 (R448G)
Ref Sequence ENSEMBL: ENSMUSP00000058676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037356] [ENSMUST00000059790] [ENSMUST00000132915] [ENSMUST00000155157]
Predicted Effect probably damaging
Transcript: ENSMUST00000037356
AA Change: R448G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041323
Gene: ENSMUSG00000046862
AA Change: R448G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 205 410 3e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059790
AA Change: R448G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058676
Gene: ENSMUSG00000046862
AA Change: R448G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 205 410 3e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126398
Predicted Effect probably benign
Transcript: ENSMUST00000132915
Predicted Effect probably benign
Transcript: ENSMUST00000155157
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Pramef8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pramef8 APN 4 143416667 start codon destroyed probably null 1.00
IGL01483:Pramef8 APN 4 143417477 missense probably damaging 0.99
IGL01800:Pramef8 APN 4 143419080 missense probably damaging 1.00
IGL02063:Pramef8 APN 4 143417851 missense probably benign 0.00
IGL02216:Pramef8 APN 4 143417728 unclassified probably null
IGL02236:Pramef8 APN 4 143416942 missense probably benign 0.07
IGL03013:Pramef8 APN 4 143417467 missense possibly damaging 0.64
R0658:Pramef8 UTSW 4 143417600 missense probably damaging 1.00
R1485:Pramef8 UTSW 4 143417618 missense probably benign 0.01
R2049:Pramef8 UTSW 4 143416871 missense probably damaging 1.00
R2518:Pramef8 UTSW 4 143417903 missense possibly damaging 0.89
R3720:Pramef8 UTSW 4 143419379 missense probably benign 0.10
R3738:Pramef8 UTSW 4 143416642 utr 5 prime probably benign
R3961:Pramef8 UTSW 4 143419318 missense probably benign 0.00
R4583:Pramef8 UTSW 4 143416754 missense probably damaging 1.00
R5135:Pramef8 UTSW 4 143419009 missense probably benign 0.01
R5348:Pramef8 UTSW 4 143416781 missense probably damaging 1.00
R5977:Pramef8 UTSW 4 143417659 missense probably benign 0.02
R6909:Pramef8 UTSW 4 143417909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCACCAGGGTCAACTTCTATG -3'
(R):5'- GATAATGAGCAGTGTGTGGCC -3'

Sequencing Primer
(F):5'- TGACAATGACATCTCCATGGCTG -3'
(R):5'- CAGTGTGTGGCCATGTGC -3'
Posted On2016-10-06