Incidental Mutation 'R5473:Rsrc2'
ID433920
Institutional Source Beutler Lab
Gene Symbol Rsrc2
Ensembl Gene ENSMUSG00000029422
Gene Namearginine/serine-rich coiled-coil 2
Synonyms1500011J06Rik
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R5473 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123728426-123749414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123731087 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 98 (A98T)
Ref Sequence ENSEMBL: ENSMUSP00000138280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050827] [ENSMUST00000057795] [ENSMUST00000111515] [ENSMUST00000182015] [ENSMUST00000182309] [ENSMUST00000182489] [ENSMUST00000182556] [ENSMUST00000182955] [ENSMUST00000183147]
Predicted Effect probably damaging
Transcript: ENSMUST00000050827
AA Change: A271T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050563
Gene: ENSMUSG00000029422
AA Change: A271T

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
low complexity region 108 208 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
coiled coil region 228 272 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
Pfam:SMAP 354 423 6.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057795
AA Change: A271T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049942
Gene: ENSMUSG00000029422
AA Change: A271T

DomainStartEndE-ValueType
low complexity region 50 150 N/A INTRINSIC
low complexity region 151 168 N/A INTRINSIC
coiled coil region 170 214 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
Pfam:SMAP 295 365 4.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111515
SMART Domains Protein: ENSMUSP00000107140
Gene: ENSMUSG00000029422

DomainStartEndE-ValueType
low complexity region 50 150 N/A INTRINSIC
low complexity region 151 168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181980
Predicted Effect probably benign
Transcript: ENSMUST00000182015
SMART Domains Protein: ENSMUSP00000138210
Gene: ENSMUSG00000029422

DomainStartEndE-ValueType
low complexity region 36 69 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182309
AA Change: A329T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138691
Gene: ENSMUSG00000029422
AA Change: A329T

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
low complexity region 108 208 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
coiled coil region 228 272 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
Pfam:SMAP 353 423 4.7e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182489
AA Change: A282T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138518
Gene: ENSMUSG00000029422
AA Change: A282T

DomainStartEndE-ValueType
internal_repeat_1 10 46 8.8e-5 PROSPERO
low complexity region 61 161 N/A INTRINSIC
low complexity region 162 179 N/A INTRINSIC
coiled coil region 181 225 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
Pfam:SMAP 306 376 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182556
SMART Domains Protein: ENSMUSP00000138631
Gene: ENSMUSG00000029422

DomainStartEndE-ValueType
low complexity region 50 150 N/A INTRINSIC
low complexity region 151 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182744
Predicted Effect probably benign
Transcript: ENSMUST00000182861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182948
Predicted Effect probably damaging
Transcript: ENSMUST00000182955
AA Change: A98T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138280
Gene: ENSMUSG00000029422
AA Change: A98T

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
Pfam:SMAP 122 192 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182985
Predicted Effect probably damaging
Transcript: ENSMUST00000183147
AA Change: A98T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Rsrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Rsrc2 APN 5 123739622 utr 5 prime probably benign
IGL03268:Rsrc2 APN 5 123740727 nonsense probably null
PIT4519001:Rsrc2 UTSW 5 123745072 missense unknown
R0254:Rsrc2 UTSW 5 123740847 utr 5 prime probably benign
R2889:Rsrc2 UTSW 5 123736557 critical splice donor site probably benign
R3875:Rsrc2 UTSW 5 123736628 utr 5 prime probably benign
R4914:Rsrc2 UTSW 5 123739550 utr 5 prime probably benign
R5200:Rsrc2 UTSW 5 123739499 nonsense probably null
R5237:Rsrc2 UTSW 5 123739582 utr 5 prime probably benign
R6263:Rsrc2 UTSW 5 123739688 start gained probably benign
R6657:Rsrc2 UTSW 5 123739567 utr 5 prime probably benign
R6806:Rsrc2 UTSW 5 123739531 utr 5 prime probably benign
R7145:Rsrc2 UTSW 5 123739567 utr 5 prime probably benign
X0020:Rsrc2 UTSW 5 123729223 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGCTGCTTATTAGTACCTGCTAC -3'
(R):5'- CCACTGGAGGTTCAGTTCTTAATG -3'

Sequencing Primer
(F):5'- TGCTACCCACCCCTTATAAATATATG -3'
(R):5'- CAGTTCTTAATGTTGCTGCACTG -3'
Posted On2016-10-06