Incidental Mutation 'R5473:Fam83b'
ID433933
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Namefamily with sequence similarity 83, member B
SynonymsC530008M07Rik
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5473 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76490054-76567116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76491500 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 774 (K774E)
Ref Sequence ENSEMBL: ENSMUSP00000139354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
Predicted Effect probably damaging
Transcript: ENSMUST00000098546
AA Change: K774E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: K774E

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183437
AA Change: K774E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: K774E

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76490978 missense probably benign 0.00
IGL01554:Fam83b APN 9 76502121 missense probably benign 0.33
IGL01694:Fam83b APN 9 76490990 missense probably benign 0.13
IGL02009:Fam83b APN 9 76492322 missense probably damaging 1.00
IGL02531:Fam83b APN 9 76492000 missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76493042 missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76491152 missense probably damaging 1.00
R0110:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76492928 nonsense probably null
R0946:Fam83b UTSW 9 76491397 missense probably damaging 0.96
R0961:Fam83b UTSW 9 76491295 missense probably damaging 0.97
R1101:Fam83b UTSW 9 76545670 missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76492312 missense probably damaging 1.00
R1248:Fam83b UTSW 9 76503076 missense probably benign 0.35
R1420:Fam83b UTSW 9 76492612 missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76492577 missense probably benign
R1939:Fam83b UTSW 9 76493080 missense probably damaging 1.00
R1992:Fam83b UTSW 9 76492022 missense probably benign
R2102:Fam83b UTSW 9 76492705 missense probably damaging 0.96
R2134:Fam83b UTSW 9 76491016 missense probably damaging 1.00
R2398:Fam83b UTSW 9 76502218 missense probably damaging 1.00
R2878:Fam83b UTSW 9 76490810 missense probably damaging 1.00
R4092:Fam83b UTSW 9 76491661 missense probably benign 0.24
R4204:Fam83b UTSW 9 76503053 missense probably benign 0.09
R4537:Fam83b UTSW 9 76492142 missense probably benign 0.10
R4920:Fam83b UTSW 9 76491868 missense probably benign
R5456:Fam83b UTSW 9 76492595 missense probably benign
R5488:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5489:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5876:Fam83b UTSW 9 76491850 missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76492357 missense probably damaging 1.00
R6374:Fam83b UTSW 9 76492907 missense probably benign 0.31
R6468:Fam83b UTSW 9 76502131 nonsense probably null
R6912:Fam83b UTSW 9 76490932 missense probably damaging 0.99
R7022:Fam83b UTSW 9 76502112 frame shift probably null
R7073:Fam83b UTSW 9 76545749 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GAGGAACGCTTTCTTCTGGGAG -3'
(R):5'- GAGGTTGTGCTGAAGAGCTC -3'

Sequencing Primer
(F):5'- CGCTTTCTTCTGGGAGATGAATCAAC -3'
(R):5'- GTTGTGCTGAAGAGCTCTAAAAG -3'
Posted On2016-10-06