Incidental Mutation 'R5473:Myl3'
ID433934
Institutional Source Beutler Lab
Gene Symbol Myl3
Ensembl Gene ENSMUSG00000059741
Gene Namemyosin, light polypeptide 3
SynonymsMLC1v, alkali, slow skeletal, MLC1s, Mylc, ventricular
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R5473 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110741861-110769798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110767958 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 129 (H129N)
Ref Sequence ENSEMBL: ENSMUSP00000142530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079784] [ENSMUST00000124267] [ENSMUST00000136695] [ENSMUST00000200011]
Predicted Effect probably damaging
Transcript: ENSMUST00000079784
AA Change: H129N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078715
Gene: ENSMUSG00000059741
AA Change: H129N

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
internal_repeat_1 61 124 1.28e-5 PROSPERO
internal_repeat_1 140 198 1.28e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000124267
AA Change: H52N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142424
Gene: ENSMUSG00000059741
AA Change: H52N

DomainStartEndE-ValueType
SCOP:d1ggwa_ 1 127 2e-23 SMART
PDB:1W7J|B 2 126 3e-68 PDB
Blast:EFh 64 92 5e-12 BLAST
Blast:EFh 99 126 2e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000136695
AA Change: H52N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142791
Gene: ENSMUSG00000059741
AA Change: H52N

DomainStartEndE-ValueType
SCOP:d1ggwa_ 1 127 2e-23 SMART
PDB:1W7J|B 2 126 3e-68 PDB
Blast:EFh 64 92 5e-12 BLAST
Blast:EFh 99 126 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153142
Predicted Effect probably damaging
Transcript: ENSMUST00000200011
AA Change: H129N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142530
Gene: ENSMUSG00000059741
AA Change: H129N

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:EF-hand_6 62 93 4.7e-3 PFAM
internal_repeat_1 140 182 5.24e-5 PROSPERO
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYL3 encodes myosin light chain 3, an alkali light chain also referred to in the literature as both the ventricular isoform and the slow skeletal muscle isoform. Mutations in MYL3 have been identified as a cause of mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Myl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Myl3 APN 9 110766489 missense possibly damaging 0.95
IGL01292:Myl3 APN 9 110767977 missense probably damaging 1.00
IGL02814:Myl3 APN 9 110767991 nonsense probably null
R0009:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0010:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0015:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0040:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0045:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0045:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0080:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0081:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0095:Myl3 UTSW 9 110767929 missense probably damaging 1.00
R0194:Myl3 UTSW 9 110769121 missense probably benign 0.00
R1938:Myl3 UTSW 9 110766734 missense probably damaging 1.00
R2230:Myl3 UTSW 9 110767911 missense probably damaging 1.00
R2231:Myl3 UTSW 9 110767911 missense probably damaging 1.00
R2315:Myl3 UTSW 9 110766741 missense probably damaging 1.00
R3884:Myl3 UTSW 9 110767959 missense probably damaging 1.00
R7059:Myl3 UTSW 9 110742037 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TTTGTACACAGCACATGCATC -3'
(R):5'- TTTCACAGACAAGACACGGGC -3'

Sequencing Primer
(F):5'- AGCACATGCATCAGTGTGC -3'
(R):5'- TGACACAAAGGTTTCCCTAGG -3'
Posted On2016-10-06