Incidental Mutation 'R5473:Fgd6'
ID433938
Institutional Source Beutler Lab
Gene Symbol Fgd6
Ensembl Gene ENSMUSG00000020021
Gene NameFYVE, RhoGEF and PH domain containing 6
SynonymsEtohd4, ZFYVE24
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R5473 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location94036001-94145339 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94044676 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 464 (I464T)
Ref Sequence ENSEMBL: ENSMUSP00000020208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020208]
PDB Structure
Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000020208
AA Change: I464T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021
AA Change: I464T

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
RhoGEF 845 1029 3.09e-46 SMART
PH 1060 1155 6.25e-15 SMART
FYVE 1183 1251 6.93e-28 SMART
low complexity region 1268 1282 N/A INTRINSIC
PH 1303 1398 1.54e-5 SMART
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Fgd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Fgd6 APN 10 94043634 missense probably benign 0.01
IGL00975:Fgd6 APN 10 94134076 missense probably damaging 0.98
IGL01366:Fgd6 APN 10 94043476 missense possibly damaging 0.71
IGL01940:Fgd6 APN 10 94089650 splice site probably null
IGL01958:Fgd6 APN 10 94138308 missense probably benign 0.25
IGL01988:Fgd6 APN 10 94074335 splice site probably benign
IGL02019:Fgd6 APN 10 94133354 missense probably damaging 1.00
IGL02074:Fgd6 APN 10 94127435 missense probably damaging 1.00
IGL02227:Fgd6 APN 10 94134084 missense probably damaging 1.00
IGL02262:Fgd6 APN 10 94125628 missense probably damaging 0.98
IGL02353:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02360:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02425:Fgd6 APN 10 94074202 missense probably benign 0.00
IGL02526:Fgd6 APN 10 94100511 missense probably benign 0.21
IGL02607:Fgd6 APN 10 94044448 missense possibly damaging 0.94
IGL02741:Fgd6 APN 10 94123290 missense possibly damaging 0.65
IGL02870:Fgd6 APN 10 94045164 missense probably damaging 1.00
IGL02884:Fgd6 APN 10 94045639 splice site probably benign
IGL02995:Fgd6 APN 10 94045480 nonsense probably null
IGL03189:Fgd6 APN 10 94044456 missense probably benign 0.26
IGL03258:Fgd6 APN 10 94133353 missense probably benign 0.44
IGL03396:Fgd6 APN 10 94044456 missense probably benign 0.26
FR4449:Fgd6 UTSW 10 94044320 small deletion probably benign
R0257:Fgd6 UTSW 10 94043915 missense probably benign 0.11
R0926:Fgd6 UTSW 10 94135047 missense probably benign 0.40
R1325:Fgd6 UTSW 10 94127427 missense probably damaging 1.00
R1422:Fgd6 UTSW 10 94045372 missense probably damaging 1.00
R1491:Fgd6 UTSW 10 94044832 missense probably benign 0.06
R1593:Fgd6 UTSW 10 94045032 missense probably damaging 1.00
R1624:Fgd6 UTSW 10 94137436 missense probably benign 0.19
R1929:Fgd6 UTSW 10 94045006 missense probably benign 0.01
R2064:Fgd6 UTSW 10 94045041 missense probably damaging 0.98
R2965:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R2966:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R3889:Fgd6 UTSW 10 94089637 missense probably damaging 1.00
R4094:Fgd6 UTSW 10 94043434 missense probably damaging 1.00
R4605:Fgd6 UTSW 10 94044355 missense probably benign 0.12
R4883:Fgd6 UTSW 10 94139853 missense probably benign 0.00
R5217:Fgd6 UTSW 10 94134077 missense possibly damaging 0.90
R5606:Fgd6 UTSW 10 94138328 nonsense probably null
R5644:Fgd6 UTSW 10 94134050 missense possibly damaging 0.80
R6051:Fgd6 UTSW 10 94137565 critical splice donor site probably null
R6258:Fgd6 UTSW 10 94044299 missense probably benign 0.00
R6735:Fgd6 UTSW 10 94074320 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCAAACGCCTTCTTTAGATACAG -3'
(R):5'- TCAAAGGGTGATGCTGACGC -3'

Sequencing Primer
(F):5'- GATTCTAGTTTGACTTCTGACAGCAG -3'
(R):5'- CTGACGCGCCATGGTTTG -3'
Posted On2016-10-06