Incidental Mutation 'R5473:Nsd1'
ID433944
Institutional Source Beutler Lab
Gene Symbol Nsd1
Ensembl Gene ENSMUSG00000021488
Gene Namenuclear receptor-binding SET-domain protein 1
SynonymsKMT3B
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5473 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55209782-55318325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55247772 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1165 (N1165S)
Ref Sequence ENSEMBL: ENSMUSP00000097089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]
Predicted Effect probably damaging
Transcript: ENSMUST00000099490
AA Change: N1165S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: N1165S

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224973
AA Change: N1062S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Nsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Nsd1 APN 13 55238735 missense probably damaging 1.00
IGL01060:Nsd1 APN 13 55263429 missense probably damaging 1.00
IGL01125:Nsd1 APN 13 55245617 missense probably damaging 1.00
IGL01746:Nsd1 APN 13 55276515 splice site probably null
IGL02437:Nsd1 APN 13 55313441 missense probably damaging 1.00
IGL02530:Nsd1 APN 13 55302833 splice site probably benign
IGL02557:Nsd1 APN 13 55312448 missense probably damaging 1.00
IGL02572:Nsd1 APN 13 55296130 missense probably damaging 1.00
IGL02665:Nsd1 APN 13 55296183 missense probably damaging 1.00
IGL02870:Nsd1 APN 13 55313603 missense probably benign 0.06
IGL03181:Nsd1 APN 13 55247045 missense probably damaging 1.00
PIT4480001:Nsd1 UTSW 13 55213918 missense probably benign 0.11
R0316:Nsd1 UTSW 13 55213771 missense probably damaging 0.98
R0519:Nsd1 UTSW 13 55312835 missense probably benign 0.04
R0542:Nsd1 UTSW 13 55260458 missense possibly damaging 0.93
R0563:Nsd1 UTSW 13 55246578 missense possibly damaging 0.48
R0652:Nsd1 UTSW 13 55247586 missense possibly damaging 0.92
R0906:Nsd1 UTSW 13 55277590 missense probably benign 0.30
R1560:Nsd1 UTSW 13 55246720 nonsense probably null
R1572:Nsd1 UTSW 13 55246969 missense probably damaging 0.98
R1693:Nsd1 UTSW 13 55247261 missense probably benign
R1697:Nsd1 UTSW 13 55214059 critical splice acceptor site probably null
R1720:Nsd1 UTSW 13 55246898 missense probably damaging 0.98
R1829:Nsd1 UTSW 13 55246369 missense probably damaging 1.00
R1834:Nsd1 UTSW 13 55313351 missense possibly damaging 0.52
R1842:Nsd1 UTSW 13 55246445 missense probably damaging 1.00
R1880:Nsd1 UTSW 13 55213793 missense probably damaging 0.99
R2022:Nsd1 UTSW 13 55213279 missense probably damaging 0.99
R2075:Nsd1 UTSW 13 55310500 missense possibly damaging 0.74
R2143:Nsd1 UTSW 13 55260397 missense probably damaging 1.00
R2151:Nsd1 UTSW 13 55291236 missense probably damaging 1.00
R2316:Nsd1 UTSW 13 55233966 missense probably damaging 1.00
R2359:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2361:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2656:Nsd1 UTSW 13 55246868 missense probably damaging 1.00
R2849:Nsd1 UTSW 13 55213692 missense probably damaging 0.99
R3237:Nsd1 UTSW 13 55312888 missense possibly damaging 0.92
R3772:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3773:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3849:Nsd1 UTSW 13 55246691 missense probably benign 0.00
R3951:Nsd1 UTSW 13 55268454 missense probably benign 0.05
R4036:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R4073:Nsd1 UTSW 13 55247728 missense probably benign 0.28
R4080:Nsd1 UTSW 13 55301809 missense probably damaging 0.96
R4226:Nsd1 UTSW 13 55260401 missense probably damaging 1.00
R4485:Nsd1 UTSW 13 55245621 missense probably benign
R4703:Nsd1 UTSW 13 55214063 missense probably damaging 1.00
R4853:Nsd1 UTSW 13 55268504 missense probably benign 0.30
R4915:Nsd1 UTSW 13 55247868 missense possibly damaging 0.65
R4915:Nsd1 UTSW 13 55276528 missense probably benign 0.00
R5264:Nsd1 UTSW 13 55247346 missense possibly damaging 0.49
R5348:Nsd1 UTSW 13 55312334 missense probably benign 0.00
R5498:Nsd1 UTSW 13 55213302 nonsense probably null
R5503:Nsd1 UTSW 13 55245939 missense probably damaging 1.00
R5511:Nsd1 UTSW 13 55312730 missense probably benign 0.00
R5683:Nsd1 UTSW 13 55246148 missense probably benign 0.00
R5778:Nsd1 UTSW 13 55306979 missense probably damaging 1.00
R5793:Nsd1 UTSW 13 55248006 missense probably benign
R5922:Nsd1 UTSW 13 55247475 missense probably benign 0.01
R5956:Nsd1 UTSW 13 55263404 missense probably damaging 1.00
R6053:Nsd1 UTSW 13 55293609 missense probably damaging 1.00
R6141:Nsd1 UTSW 13 55291284 missense probably damaging 1.00
R6158:Nsd1 UTSW 13 55245621 missense probably benign
R6224:Nsd1 UTSW 13 55313132 missense possibly damaging 0.85
R6396:Nsd1 UTSW 13 55238789 missense probably damaging 1.00
R6598:Nsd1 UTSW 13 55293702 missense possibly damaging 0.94
R7170:Nsd1 UTSW 13 55261626 nonsense probably null
R7205:Nsd1 UTSW 13 55246470 missense probably damaging 1.00
R7215:Nsd1 UTSW 13 55247641 missense probably benign 0.00
Z1088:Nsd1 UTSW 13 55213848 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGCCTCTGCAACAAATGGAC -3'
(R):5'- GCCATGATTGGGATCTGCTG -3'

Sequencing Primer
(F):5'- CCTCTGCAACAAATGGACCTTTTAAG -3'
(R):5'- GGATCTGCTGCTGAGTCCTC -3'
Posted On2016-10-06