Incidental Mutation 'R5473:Hnrnpk'
ID433945
Institutional Source Beutler Lab
Gene Symbol Hnrnpk
Ensembl Gene ENSMUSG00000021546
Gene Nameheterogeneous nuclear ribonucleoprotein K
SynonymshnRNPK, KBBP, Hnrpk
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R5473 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58391142-58403343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58394099 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 333 (W333R)
Ref Sequence ENSEMBL: ENSMUSP00000135647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043269] [ENSMUST00000116403] [ENSMUST00000175847] [ENSMUST00000176207] [ENSMUST00000176305] [ENSMUST00000176558] [ENSMUST00000176849] [ENSMUST00000177019] [ENSMUST00000177060] [ENSMUST00000177117] [ENSMUST00000177497] [ENSMUST00000224030] [ENSMUST00000224182] [ENSMUST00000224342] [ENSMUST00000224524] [ENSMUST00000224836] [ENSMUST00000225031] [ENSMUST00000225176] [ENSMUST00000225674]
Predicted Effect probably benign
Transcript: ENSMUST00000043269
AA Change: W357R

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039269
Gene: ENSMUSG00000021546
AA Change: W357R

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 143 214 2.66e-12 SMART
low complexity region 252 279 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
KH 386 456 3.12e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083500
Predicted Effect probably benign
Transcript: ENSMUST00000116403
AA Change: W357R

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112104
Gene: ENSMUSG00000021546
AA Change: W357R

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 143 214 2.66e-12 SMART
low complexity region 252 279 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
KH 386 456 3.12e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175847
SMART Domains Protein: ENSMUSP00000134837
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
Pfam:ROKNT 1 43 7.6e-24 PFAM
Pfam:KH_4 21 70 1.4e-9 PFAM
Pfam:KH_2 25 74 4.4e-7 PFAM
Pfam:KH_1 44 72 3.5e-8 PFAM
Pfam:KH_3 54 73 9.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175939
Predicted Effect probably benign
Transcript: ENSMUST00000176207
AA Change: W333R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135354
Gene: ENSMUSG00000021546
AA Change: W333R

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 119 190 2.66e-12 SMART
low complexity region 228 255 N/A INTRINSIC
low complexity region 261 277 N/A INTRINSIC
low complexity region 283 291 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 341 357 N/A INTRINSIC
KH 362 432 3.12e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176269
Predicted Effect probably benign
Transcript: ENSMUST00000176305
SMART Domains Protein: ENSMUSP00000135305
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 143 214 2.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176359
Predicted Effect probably benign
Transcript: ENSMUST00000176558
SMART Domains Protein: ENSMUSP00000135623
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 96 6.49e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176725
Predicted Effect unknown
Transcript: ENSMUST00000176797
AA Change: W153R
Predicted Effect probably benign
Transcript: ENSMUST00000176849
SMART Domains Protein: ENSMUSP00000135342
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 119 190 2.66e-12 SMART
low complexity region 228 255 N/A INTRINSIC
low complexity region 261 277 N/A INTRINSIC
low complexity region 283 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176888
Predicted Effect probably damaging
Transcript: ENSMUST00000177019
AA Change: W333R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135647
Gene: ENSMUSG00000021546
AA Change: W333R

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 119 190 2.66e-12 SMART
low complexity region 228 255 N/A INTRINSIC
low complexity region 261 277 N/A INTRINSIC
low complexity region 283 291 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 341 357 N/A INTRINSIC
KH 362 432 3.12e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177051
Predicted Effect probably benign
Transcript: ENSMUST00000177060
SMART Domains Protein: ENSMUSP00000135407
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 38 106 4.56e-11 SMART
KH 116 177 2.28e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177117
SMART Domains Protein: ENSMUSP00000135109
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
Blast:KH 3 40 2e-18 BLAST
Pfam:KH_1 53 87 2.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177377
Predicted Effect possibly damaging
Transcript: ENSMUST00000177497
AA Change: W288R

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135833
Gene: ENSMUSG00000021546
AA Change: W288R

DomainStartEndE-ValueType
Blast:KH 3 40 8e-16 BLAST
KH 74 145 2.66e-12 SMART
low complexity region 183 210 N/A INTRINSIC
low complexity region 216 232 N/A INTRINSIC
low complexity region 238 246 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
KH 317 387 3.12e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224030
Predicted Effect probably benign
Transcript: ENSMUST00000224182
AA Change: W357R

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000224342
Predicted Effect probably benign
Transcript: ENSMUST00000224524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224782
Predicted Effect probably benign
Transcript: ENSMUST00000224836
Predicted Effect probably benign
Transcript: ENSMUST00000225031
Predicted Effect probably benign
Transcript: ENSMUST00000225176
Predicted Effect probably benign
Transcript: ENSMUST00000225674
AA Change: W357R

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226015
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex, and is a poly-cytosine binding protein (PCBP). It is found in multiple subcellular compartments including the nucleus, cytoplasm and mitochondria. This gene product is thought to interact with RNA, DNA, and protein, and is involved in multiple cellular processes, including transcription, chromatin remodeling, DNA damage response, signal transduction, mRNA splicing, export, and translation. Multiple transcript variants and protein isoforms exist, with some isoforms containing a unique C-terminus. There are four pseudogenes of this gene, found on chromosomes 2, 3, 7 and 13. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Hnrnpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Hnrnpk APN 13 58395297 splice site probably benign
IGL03181:Hnrnpk APN 13 58394316 missense possibly damaging 0.67
R0136:Hnrnpk UTSW 13 58395177 missense probably benign 0.01
R1131:Hnrnpk UTSW 13 58394165 splice site probably null
R1690:Hnrnpk UTSW 13 58400354 missense probably benign 0.23
R1956:Hnrnpk UTSW 13 58396186 critical splice donor site probably null
R4525:Hnrnpk UTSW 13 58393882 splice site probably benign
R4663:Hnrnpk UTSW 13 58394517 missense probably damaging 0.98
R4754:Hnrnpk UTSW 13 58399136 unclassified probably benign
R5830:Hnrnpk UTSW 13 58397734 nonsense probably null
R5937:Hnrnpk UTSW 13 58395202 missense probably damaging 1.00
R5997:Hnrnpk UTSW 13 58399157 missense probably damaging 1.00
R6188:Hnrnpk UTSW 13 58394153 missense probably benign 0.11
R6461:Hnrnpk UTSW 13 58393194 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCACCATATGAGCCACGGC -3'
(R):5'- GGCATGTGTGTTTTCAGAGACC -3'

Sequencing Primer
(F):5'- GGCCCCCTGCATAAGAATAGTCTG -3'
(R):5'- GTGTGTTTTCAGAGACCTTATAACC -3'
Posted On2016-10-06