Incidental Mutation 'R5473:Hrh4'
ID433956
Institutional Source Beutler Lab
Gene Symbol Hrh4
Ensembl Gene ENSMUSG00000037346
Gene Namehistamine receptor H4
SynonymsH4R
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5473 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location13006990-13022882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13021928 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 175 (Y175H)
Ref Sequence ENSEMBL: ENSMUSP00000041061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041676]
Predicted Effect probably benign
Transcript: ENSMUST00000041676
AA Change: Y175H

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041061
Gene: ENSMUSG00000037346
AA Change: Y175H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 26 211 1e-5 PFAM
Pfam:7tm_1 32 360 8.1e-58 PFAM
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by a family of histamine receptors, which are a subset of the G-protein coupled receptor superfamily. This gene encodes a histamine receptor that is predominantly expressed in haematopoietic cells. The protein is thought to play a role in inflammation and allergy reponses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased allergic response to airway inflammation and decreased Th2 responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
Gorasp2 A C 2: 70,678,606 M123L probably damaging Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Hrh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Hrh4 APN 18 13015947 splice site probably benign
IGL01544:Hrh4 APN 18 13015893 missense probably benign 0.22
IGL01765:Hrh4 APN 18 13007195 missense probably damaging 1.00
IGL02117:Hrh4 APN 18 13022420 missense probably benign 0.02
IGL02559:Hrh4 APN 18 13007244 critical splice donor site probably null
IGL03277:Hrh4 APN 18 13015883 missense probably damaging 1.00
IGL03281:Hrh4 APN 18 13022469 missense possibly damaging 0.94
R0267:Hrh4 UTSW 18 13022398 nonsense probably null
R0329:Hrh4 UTSW 18 13007245 splice site probably benign
R1601:Hrh4 UTSW 18 13015898 missense possibly damaging 0.86
R1827:Hrh4 UTSW 18 13022204 missense probably damaging 0.97
R2964:Hrh4 UTSW 18 13022369 missense probably benign 0.43
R3843:Hrh4 UTSW 18 13022286 missense possibly damaging 0.77
R5262:Hrh4 UTSW 18 13015813 missense probably damaging 0.99
R5325:Hrh4 UTSW 18 13021997 nonsense probably null
R6500:Hrh4 UTSW 18 13022468 missense probably damaging 0.98
R6622:Hrh4 UTSW 18 13022397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATATCCCTGGAACATGTG -3'
(R):5'- CAGCTCTGTGTAAGTGTCCTG -3'

Sequencing Primer
(F):5'- AACCACATTAGTTGTCTGGTTTC -3'
(R):5'- CTCTGTGTAAGTGTCCTGAAGCAC -3'
Posted On2016-10-06