Mutagenetix > Incidental Mutation

Incidental Mutation 'R5475:Cacna1e'

433999

Institutional Source

Beutler Lab

Gene Symbol

Cacna1e

Ensembl Gene

ENSMUSG00000004110

Gene Name

calcium channel, voltage-dependent, R type, alpha 1E subunit

Synonyms

Cav2.3, Cchra1, alpha1E

MMRRC Submission

043036-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R5475 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

154266477-154760247 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 154601455 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 71 (F71I)

Ref Sequence

ENSEMBL: ENSMUSP00000140937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000004214

SMART Domains

Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	55	6.7e-10	PFAM
Pfam:Ion_trans	168	407	3.3e-56	PFAM
Pfam:PKD_channel	257	401	3.3e-7	PFAM
low complexity region	409	414	N/A	INTRINSIC
low complexity region	455	469	N/A	INTRINSIC
low complexity region	496	514	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC
low complexity region	626	640	N/A	INTRINSIC
coiled coil region	793	823	N/A	INTRINSIC
Pfam:Ion_trans	847	1128	2.3e-63	PFAM
Pfam:Ion_trans	1172	1429	2.6e-65	PFAM
Pfam:PKD_channel	1256	1424	2.8e-10	PFAM
Pfam:GPHH	1431	1500	1.3e-37	PFAM
Ca_chan_IQ	1555	1589	5.93e-13	SMART
low complexity region	1701	1717	N/A	INTRINSIC
low complexity region	1729	1742	N/A	INTRINSIC
low complexity region	1764	1780	N/A	INTRINSIC
low complexity region	1789	1804	N/A	INTRINSIC
low complexity region	1808	1822	N/A	INTRINSIC
low complexity region	1832	1846	N/A	INTRINSIC
low complexity region	1867	1878	N/A	INTRINSIC
low complexity region	1936	1946	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000187541
AA Change: F71I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: F71I

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	351	8.5e-54	PFAM
PDB:4DEX\|B	354	462	6e-36	PDB
Pfam:Ion_trans	511	703	2.2e-46	PFAM
Pfam:PKD_channel	565	710	1.4e-6	PFAM
low complexity region	717	722	N/A	INTRINSIC
low complexity region	763	777	N/A	INTRINSIC
low complexity region	804	822	N/A	INTRINSIC
low complexity region	912	928	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
coiled coil region	1101	1131	N/A	INTRINSIC
low complexity region	1162	1175	N/A	INTRINSIC
Pfam:Ion_trans	1191	1425	4.3e-55	PFAM
Pfam:Ion_trans	1515	1725	5.3e-60	PFAM
Pfam:PKD_channel	1565	1732	4.7e-10	PFAM
Ca_chan_IQ	1863	1897	5.93e-13	SMART
low complexity region	2009	2025	N/A	INTRINSIC
low complexity region	2037	2050	N/A	INTRINSIC
low complexity region	2072	2088	N/A	INTRINSIC
low complexity region	2097	2112	N/A	INTRINSIC
low complexity region	2116	2130	N/A	INTRINSIC
low complexity region	2140	2154	N/A	INTRINSIC
low complexity region	2175	2186	N/A	INTRINSIC
low complexity region	2244	2254	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188321

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188965

Predicted Effect

probably benign
Transcript: ENSMUST00000211821

Meta Mutation Damage Score

0.8648

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.5%
20x: 91.8%

Validation Efficiency

96% (72/75)

MGI Phenotype

FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,376,349 (GRCm39)	V173M	probably damaging	Het
AA467197	A	G	2: 122,482,646 (GRCm39)	K70R	probably damaging	Het
Agr3	A	G	12: 35,997,539 (GRCm39)	N83S	probably benign	Het
Alpk2	T	C	18: 65,440,083 (GRCm39)	T904A	probably benign	Het
Ank	A	T	15: 27,557,285 (GRCm39)	K156N	probably damaging	Het
Arsb	T	G	13: 93,998,773 (GRCm39)	D360E	probably benign	Het
Atg14	C	T	14: 47,805,793 (GRCm39)	R24Q	possibly damaging	Het
Cdc42bpg	T	C	19: 6,361,101 (GRCm39)	I242T	probably damaging	Het
Cngb1	A	T	8: 95,978,597 (GRCm39)	I588N	probably damaging	Het
Col6a6	T	C	9: 105,651,537 (GRCm39)	H1158R	probably null	Het
Cse1l	T	C	2: 166,783,174 (GRCm39)	S684P	probably damaging	Het
Cyp2c29	A	T	19: 39,318,731 (GRCm39)	M404L	possibly damaging	Het
D5Ertd579e	G	T	5: 36,772,601 (GRCm39)	S598Y	probably damaging	Het
Dph7	A	T	2: 24,858,969 (GRCm39)		probably null	Het
Dsg1c	A	T	18: 20,415,088 (GRCm39)	N662Y	probably damaging	Het
Efcab9	T	G	11: 32,472,862 (GRCm39)	D195A	probably damaging	Het
Ephb4	A	G	5: 137,352,701 (GRCm39)	M95V	probably benign	Het
Fam171a1	A	T	2: 3,226,334 (GRCm39)	Y489F	possibly damaging	Het
Fars2	T	C	13: 36,388,553 (GRCm39)	I14T	probably benign	Het
Fbxo34	T	C	14: 47,766,802 (GRCm39)	V54A	probably benign	Het
Fbxw17	T	C	13: 50,579,684 (GRCm39)	I167T	probably benign	Het
Fzd9	A	T	5: 135,279,123 (GRCm39)		probably null	Het
Gm26996	T	A	6: 130,556,918 (GRCm39)		noncoding transcript	Het
Gm4744	A	G	6: 40,927,388 (GRCm39)		probably benign	Het
Gm4744	T	A	6: 40,927,403 (GRCm39)		probably benign	Het
Gprc5c	G	T	11: 114,755,093 (GRCm39)	V257L	possibly damaging	Het
Has1	C	A	17: 18,068,583 (GRCm39)	R257L	possibly damaging	Het
Hjv	T	C	3: 96,434,599 (GRCm39)	S113P	probably benign	Het
Hsd17b8	C	T	17: 34,246,287 (GRCm39)		probably benign	Het
Kat2b	T	G	17: 53,970,609 (GRCm39)	V665G	probably damaging	Het
Klhdc4	T	A	8: 122,526,311 (GRCm39)	H276L	possibly damaging	Het
Klhl6	A	T	16: 19,766,877 (GRCm39)	C506S	probably damaging	Het
Ldb2	T	C	5: 44,699,174 (GRCm39)	Y88C	probably damaging	Het
Lrit1	A	G	14: 36,776,958 (GRCm39)	E26G	probably benign	Het
Mcoln2	A	G	3: 145,889,541 (GRCm39)	Y414C	probably damaging	Het
Mfsd5	A	G	15: 102,188,928 (GRCm39)	D100G	probably damaging	Het
Micall2	T	A	5: 139,702,224 (GRCm39)	S340C	probably damaging	Het
Npsr1	T	C	9: 24,211,715 (GRCm39)	I81T	probably damaging	Het
Or2bd2	G	T	7: 6,443,169 (GRCm39)	R90L	probably benign	Het
Or2t49	A	G	11: 58,392,431 (GRCm39)	V317A	probably benign	Het
Or6x1	T	A	9: 40,099,005 (GRCm39)	L198H	possibly damaging	Het
Or8b56	T	A	9: 38,739,762 (GRCm39)	F258L	possibly damaging	Het
Pax3	T	C	1: 78,080,055 (GRCm39)	T444A	probably benign	Het
Pea15a	A	G	1: 172,026,809 (GRCm39)		probably null	Het
Phc1	T	A	6: 122,311,051 (GRCm39)	Q95L	possibly damaging	Het
Plch2	T	C	4: 155,084,594 (GRCm39)	Y361C	probably damaging	Het
Pphln1-ps1	A	T	16: 13,494,977 (GRCm39)	R25S	possibly damaging	Het
Rad54l2	C	T	9: 106,583,057 (GRCm39)	G787D	probably damaging	Het
Rbm20	G	T	19: 53,823,136 (GRCm39)	E578*	probably null	Het
Sipa1l2	A	T	8: 126,218,334 (GRCm39)	D334E	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912 (GRCm39)	G252R	probably benign	Het
Thumpd1	A	G	7: 119,319,943 (GRCm39)	S8P	probably benign	Het
Tnxb	T	C	17: 34,908,567 (GRCm39)	Y1407H	probably damaging	Het
Trav2	T	A	14: 52,805,290 (GRCm39)	V37E	probably damaging	Het
Trav3-1	G	T	14: 52,818,494 (GRCm39)	W56L	probably damaging	Het
Usp31	A	T	7: 121,250,749 (GRCm39)	L808Q	probably damaging	Het
Vmn1r52	C	T	6: 90,155,894 (GRCm39)	A66V	probably benign	Het
Vmn2r105	T	A	17: 20,455,044 (GRCm39)	I31L	probably benign	Het
Wdr1	C	T	5: 38,686,931 (GRCm39)	G278S	probably damaging	Het
Zbtb2	G	T	10: 4,319,275 (GRCm39)	F250L	probably benign	Het

Other mutations in Cacna1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Cacna1e	APN	1	154,279,429 (GRCm39)	missense	probably damaging	0.99
IGL01086:Cacna1e	APN	1	154,347,347 (GRCm39)	missense	probably benign	0.04
IGL01302:Cacna1e	APN	1	154,319,653 (GRCm39)	missense	probably damaging	1.00
IGL01386:Cacna1e	APN	1	154,348,123 (GRCm39)	missense	probably benign	0.18
IGL01573:Cacna1e	APN	1	154,347,113 (GRCm39)	missense	probably benign
IGL01676:Cacna1e	APN	1	154,288,196 (GRCm39)	missense	probably damaging	1.00
IGL01676:Cacna1e	APN	1	154,274,222 (GRCm39)	missense	probably damaging	1.00
IGL01762:Cacna1e	APN	1	154,347,119 (GRCm39)	missense	possibly damaging	0.78
IGL01801:Cacna1e	APN	1	154,347,086 (GRCm39)	missense	probably null	0.00
IGL01895:Cacna1e	APN	1	154,319,646 (GRCm39)	missense	probably damaging	1.00
IGL02391:Cacna1e	APN	1	154,296,859 (GRCm39)	missense	probably damaging	1.00
IGL02399:Cacna1e	APN	1	154,279,493 (GRCm39)	missense	probably damaging	1.00
IGL02659:Cacna1e	APN	1	154,302,274 (GRCm39)	missense	probably damaging	1.00
IGL02686:Cacna1e	APN	1	154,369,155 (GRCm39)	missense	probably damaging	1.00
IGL02838:Cacna1e	APN	1	154,321,394 (GRCm39)	missense	probably damaging	1.00
IGL02958:Cacna1e	APN	1	154,341,487 (GRCm39)	missense	probably damaging	1.00
IGL02981:Cacna1e	APN	1	154,347,171 (GRCm39)	missense	probably benign	0.15
IGL03120:Cacna1e	APN	1	154,319,627 (GRCm39)	missense	probably damaging	1.00
IGL03232:Cacna1e	APN	1	154,369,104 (GRCm39)	missense	probably damaging	1.00
IGL03310:Cacna1e	APN	1	154,317,997 (GRCm39)	missense	probably damaging	1.00
IGL03342:Cacna1e	APN	1	154,342,690 (GRCm39)	critical splice donor site	probably null
bezoar	UTSW	1	154,312,300 (GRCm39)	splice site	probably null
hairball	UTSW	1	154,355,051 (GRCm39)	missense	probably damaging	0.97
N/A - 535:Cacna1e	UTSW	1	154,341,510 (GRCm39)	missense	probably damaging	1.00
R0122:Cacna1e	UTSW	1	154,319,647 (GRCm39)	missense	probably damaging	1.00
R0143:Cacna1e	UTSW	1	154,324,693 (GRCm39)	splice site	probably null
R0314:Cacna1e	UTSW	1	154,317,997 (GRCm39)	missense	probably damaging	1.00
R0366:Cacna1e	UTSW	1	154,291,884 (GRCm39)	missense	probably benign	0.03
R0626:Cacna1e	UTSW	1	154,364,563 (GRCm39)	missense	probably damaging	0.99
R0739:Cacna1e	UTSW	1	154,318,024 (GRCm39)	missense	probably damaging	0.97
R1272:Cacna1e	UTSW	1	154,320,714 (GRCm39)	missense	probably damaging	1.00
R1300:Cacna1e	UTSW	1	154,274,419 (GRCm39)	missense	probably benign
R1340:Cacna1e	UTSW	1	154,348,403 (GRCm39)	missense	probably damaging	1.00
R1440:Cacna1e	UTSW	1	154,437,552 (GRCm39)	missense	possibly damaging	0.63
R1449:Cacna1e	UTSW	1	154,361,408 (GRCm39)	critical splice donor site	probably null
R1538:Cacna1e	UTSW	1	154,437,504 (GRCm39)	missense	probably damaging	0.99
R1542:Cacna1e	UTSW	1	154,353,525 (GRCm39)	missense	probably benign	0.01
R1560:Cacna1e	UTSW	1	154,296,850 (GRCm39)	nonsense	probably null
R1748:Cacna1e	UTSW	1	154,362,315 (GRCm39)	missense	possibly damaging	0.92
R1749:Cacna1e	UTSW	1	154,319,746 (GRCm39)	missense	probably damaging	1.00
R1912:Cacna1e	UTSW	1	154,312,195 (GRCm39)	missense	probably damaging	1.00
R1968:Cacna1e	UTSW	1	154,576,240 (GRCm39)	missense	probably damaging	1.00
R1993:Cacna1e	UTSW	1	154,353,563 (GRCm39)	missense	probably damaging	0.97
R1994:Cacna1e	UTSW	1	154,353,563 (GRCm39)	missense	probably damaging	0.97
R2191:Cacna1e	UTSW	1	154,319,591 (GRCm39)	missense	probably damaging	1.00
R2291:Cacna1e	UTSW	1	154,279,429 (GRCm39)	missense	probably damaging	0.99
R2417:Cacna1e	UTSW	1	154,347,939 (GRCm39)	missense	probably damaging	1.00
R3608:Cacna1e	UTSW	1	154,291,831 (GRCm39)	missense	probably benign	0.08
R3757:Cacna1e	UTSW	1	154,509,442 (GRCm39)	missense	probably damaging	0.97
R3890:Cacna1e	UTSW	1	154,359,299 (GRCm39)	missense	probably damaging	1.00
R4015:Cacna1e	UTSW	1	154,358,331 (GRCm39)	missense	probably damaging	1.00
R4088:Cacna1e	UTSW	1	154,287,929 (GRCm39)	splice site	probably null
R4275:Cacna1e	UTSW	1	154,369,071 (GRCm39)	missense	probably damaging	1.00
R4282:Cacna1e	UTSW	1	154,302,296 (GRCm39)	missense	probably benign	0.04
R4297:Cacna1e	UTSW	1	154,274,477 (GRCm39)	missense	probably benign	0.37
R4356:Cacna1e	UTSW	1	154,319,727 (GRCm39)	missense	probably damaging	1.00
R4510:Cacna1e	UTSW	1	154,437,579 (GRCm39)	missense	probably damaging	1.00
R4511:Cacna1e	UTSW	1	154,437,579 (GRCm39)	missense	probably damaging	1.00
R4577:Cacna1e	UTSW	1	154,277,773 (GRCm39)	missense	possibly damaging	0.92
R4590:Cacna1e	UTSW	1	154,312,265 (GRCm39)	missense	possibly damaging	0.87
R4601:Cacna1e	UTSW	1	154,347,359 (GRCm39)	missense	probably benign
R4622:Cacna1e	UTSW	1	154,347,311 (GRCm39)	missense	possibly damaging	0.81
R4626:Cacna1e	UTSW	1	154,358,294 (GRCm39)	splice site	probably null
R4694:Cacna1e	UTSW	1	154,313,012 (GRCm39)	critical splice donor site	probably null
R4727:Cacna1e	UTSW	1	154,312,214 (GRCm39)	nonsense	probably null
R4839:Cacna1e	UTSW	1	154,296,804 (GRCm39)	missense	probably damaging	1.00
R4851:Cacna1e	UTSW	1	154,312,300 (GRCm39)	splice site	probably null
R4894:Cacna1e	UTSW	1	154,364,551 (GRCm39)	nonsense	probably null
R4934:Cacna1e	UTSW	1	154,357,380 (GRCm39)	nonsense	probably null
R4979:Cacna1e	UTSW	1	154,289,739 (GRCm39)	missense	probably damaging	1.00
R5077:Cacna1e	UTSW	1	154,437,475 (GRCm39)	critical splice donor site	probably null
R5128:Cacna1e	UTSW	1	154,277,767 (GRCm39)	missense	probably damaging	0.98
R5214:Cacna1e	UTSW	1	154,577,110 (GRCm39)	missense	possibly damaging	0.93
R5274:Cacna1e	UTSW	1	154,576,250 (GRCm39)	missense	probably damaging	0.98
R5388:Cacna1e	UTSW	1	154,353,542 (GRCm39)	missense	probably damaging	1.00
R5416:Cacna1e	UTSW	1	154,341,525 (GRCm39)	missense	probably damaging	1.00
R5469:Cacna1e	UTSW	1	154,319,683 (GRCm39)	missense	probably damaging	1.00
R5607:Cacna1e	UTSW	1	154,347,086 (GRCm39)	missense	probably benign	0.00
R5615:Cacna1e	UTSW	1	154,287,916 (GRCm39)	missense	probably damaging	1.00
R5616:Cacna1e	UTSW	1	154,317,940 (GRCm39)	missense	probably damaging	1.00
R5627:Cacna1e	UTSW	1	154,511,604 (GRCm39)	missense	probably damaging	0.98
R5707:Cacna1e	UTSW	1	154,509,463 (GRCm39)	missense	probably damaging	1.00
R5756:Cacna1e	UTSW	1	154,347,383 (GRCm39)	missense	probably benign	0.00
R5893:Cacna1e	UTSW	1	154,313,069 (GRCm39)	missense	probably damaging	1.00
R6117:Cacna1e	UTSW	1	154,437,537 (GRCm39)	missense	possibly damaging	0.68
R6134:Cacna1e	UTSW	1	154,577,037 (GRCm39)	missense	probably damaging	1.00
R6190:Cacna1e	UTSW	1	154,362,316 (GRCm39)	missense	possibly damaging	0.47
R6279:Cacna1e	UTSW	1	154,301,678 (GRCm39)	missense	probably benign	0.38
R6295:Cacna1e	UTSW	1	154,317,919 (GRCm39)	missense	probably damaging	0.98
R6300:Cacna1e	UTSW	1	154,301,678 (GRCm39)	missense	probably benign	0.38
R6320:Cacna1e	UTSW	1	154,317,270 (GRCm39)	missense	possibly damaging	0.76
R6375:Cacna1e	UTSW	1	154,355,051 (GRCm39)	missense	probably damaging	0.97
R6830:Cacna1e	UTSW	1	154,289,720 (GRCm39)	critical splice donor site	probably null
R6842:Cacna1e	UTSW	1	154,358,863 (GRCm39)	missense	probably damaging	1.00
R7023:Cacna1e	UTSW	1	154,601,439 (GRCm39)	missense	probably null	0.85
R7081:Cacna1e	UTSW	1	154,576,129 (GRCm39)	missense	possibly damaging	0.82
R7085:Cacna1e	UTSW	1	154,349,492 (GRCm39)	splice site	probably null
R7108:Cacna1e	UTSW	1	154,344,741 (GRCm39)	frame shift	probably null
R7142:Cacna1e	UTSW	1	154,288,230 (GRCm39)	missense	probably damaging	1.00
R7250:Cacna1e	UTSW	1	154,576,235 (GRCm39)	missense	possibly damaging	0.93
R7332:Cacna1e	UTSW	1	154,601,547 (GRCm39)	missense	possibly damaging	0.89
R7410:Cacna1e	UTSW	1	154,347,980 (GRCm39)	missense	probably benign	0.13
R7502:Cacna1e	UTSW	1	154,344,734 (GRCm39)	missense	probably null	0.35
R7556:Cacna1e	UTSW	1	154,348,419 (GRCm39)	missense	probably benign	0.28
R7563:Cacna1e	UTSW	1	154,347,162 (GRCm39)	missense	probably benign	0.00
R7573:Cacna1e	UTSW	1	154,601,911 (GRCm39)	intron	probably benign
R7689:Cacna1e	UTSW	1	154,274,549 (GRCm39)	missense	probably benign	0.01
R7699:Cacna1e	UTSW	1	154,319,674 (GRCm39)	missense	probably damaging	1.00
R7744:Cacna1e	UTSW	1	154,341,538 (GRCm39)	missense	probably damaging	1.00
R7754:Cacna1e	UTSW	1	154,288,863 (GRCm39)	missense	probably damaging	0.97
R7787:Cacna1e	UTSW	1	154,358,314 (GRCm39)	missense	probably damaging	0.98
R7818:Cacna1e	UTSW	1	154,274,152 (GRCm39)	missense	probably damaging	1.00
R7838:Cacna1e	UTSW	1	154,347,149 (GRCm39)	missense	probably benign	0.08
R7849:Cacna1e	UTSW	1	154,509,464 (GRCm39)	missense	probably damaging	1.00
R8011:Cacna1e	UTSW	1	154,341,568 (GRCm39)	missense	probably benign	0.01
R8094:Cacna1e	UTSW	1	154,437,516 (GRCm39)	missense	probably damaging	1.00
R8162:Cacna1e	UTSW	1	154,577,313 (GRCm39)	splice site	probably null
R8202:Cacna1e	UTSW	1	154,274,195 (GRCm39)	missense	probably benign
R8280:Cacna1e	UTSW	1	154,344,839 (GRCm39)	missense	probably damaging	0.97
R8354:Cacna1e	UTSW	1	154,274,314 (GRCm39)	missense	probably damaging	1.00
R8385:Cacna1e	UTSW	1	154,319,687 (GRCm39)	missense	probably damaging	0.98
R8532:Cacna1e	UTSW	1	154,341,510 (GRCm39)	missense	probably damaging	1.00
R8902:Cacna1e	UTSW	1	154,349,632 (GRCm39)	missense	probably benign	0.01
R8926:Cacna1e	UTSW	1	154,577,080 (GRCm39)	missense	possibly damaging	0.84
R8947:Cacna1e	UTSW	1	154,277,896 (GRCm39)	missense	probably benign	0.10
R9094:Cacna1e	UTSW	1	154,355,064 (GRCm39)	missense	possibly damaging	0.93
R9126:Cacna1e	UTSW	1	154,343,510 (GRCm39)	missense	probably benign	0.01
R9175:Cacna1e	UTSW	1	154,274,314 (GRCm39)	missense	probably damaging	1.00
R9286:Cacna1e	UTSW	1	154,288,845 (GRCm39)	missense	probably damaging	1.00
R9377:Cacna1e	UTSW	1	154,361,458 (GRCm39)	missense	possibly damaging	0.88
R9452:Cacna1e	UTSW	1	154,289,720 (GRCm39)	critical splice donor site	probably null
R9463:Cacna1e	UTSW	1	154,357,411 (GRCm39)	missense	probably damaging	1.00
R9513:Cacna1e	UTSW	1	154,318,033 (GRCm39)	missense	probably damaging	1.00
R9534:Cacna1e	UTSW	1	154,320,693 (GRCm39)	missense	possibly damaging	0.65
R9562:Cacna1e	UTSW	1	154,283,486 (GRCm39)	missense	probably benign	0.01
RF008:Cacna1e	UTSW	1	154,317,882 (GRCm39)	missense	probably damaging	1.00
X0062:Cacna1e	UTSW	1	154,288,238 (GRCm39)	missense	probably damaging	1.00
Z1176:Cacna1e	UTSW	1	154,511,596 (GRCm39)	missense	probably damaging	0.98
Z1177:Cacna1e	UTSW	1	154,318,038 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGAGCAAAGGGGCAAATTTTG -3'
(R):5'- AACTTCAGGATGGCTCGCTTC -3'

Sequencing Primer
(F):5'- TTTTGGCACCAGGAAGGG -3'
(R):5'- GTGGTCGTTGGCAGGCC -3'

Posted On

2016-10-06