Incidental Mutation 'R5475:Olfr923'
ID434026
Institutional Source Beutler Lab
Gene Symbol Olfr923
Ensembl Gene ENSMUSG00000044798
Gene Nameolfactory receptor 923
SynonymsGA_x6K02T2PVTD-32530445-32531380, MOR164-2
MMRRC Submission 043036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5475 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38826545-38830300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38828466 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 258 (F258L)
Ref Sequence ENSEMBL: ENSMUSP00000151652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051238] [ENSMUST00000213619] [ENSMUST00000219798]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051238
AA Change: F252L

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062073
Gene: ENSMUSG00000044798
AA Change: F252L

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 1.2e-46 PFAM
Pfam:7tm_1 47 296 3.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213550
Predicted Effect possibly damaging
Transcript: ENSMUST00000213619
AA Change: F252L

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219798
AA Change: F258L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A T 16: 13,677,113 R25S possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
AA467197 A G 2: 122,640,726 K70R probably damaging Het
Agr3 A G 12: 35,947,540 N83S probably benign Het
Alpk2 T C 18: 65,307,012 T904A probably benign Het
Ank A T 15: 27,557,199 K156N probably damaging Het
Arsb T G 13: 93,862,265 D360E probably benign Het
Atg14 C T 14: 47,568,336 R24Q possibly damaging Het
Cacna1e A T 1: 154,725,709 F71I possibly damaging Het
Cdc42bpg T C 19: 6,311,071 I242T probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Col6a6 T C 9: 105,774,338 H1158R probably null Het
Cse1l T C 2: 166,941,254 S684P probably damaging Het
Cyp2c29 A T 19: 39,330,287 M404L possibly damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dph7 A T 2: 24,968,957 probably null Het
Dsg1c A T 18: 20,282,031 N662Y probably damaging Het
Efcab9 T G 11: 32,522,862 D195A probably damaging Het
Ephb4 A G 5: 137,354,439 M95V probably benign Het
Fam171a1 A T 2: 3,225,297 Y489F possibly damaging Het
Fars2 T C 13: 36,204,570 I14T probably benign Het
Fbxo34 T C 14: 47,529,345 V54A probably benign Het
Fbxw17 T C 13: 50,425,648 I167T probably benign Het
Fzd9 A T 5: 135,250,269 probably null Het
Gm26996 T A 6: 130,579,955 noncoding transcript Het
Gm4744 A G 6: 40,950,454 probably benign Het
Gm4744 T A 6: 40,950,469 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Ke6 C T 17: 34,027,313 probably benign Het
Has1 C A 17: 17,848,321 R257L possibly damaging Het
Hfe2 T C 3: 96,527,283 S113P probably benign Het
Kat2b T G 17: 53,663,581 V665G probably damaging Het
Klhdc4 T A 8: 121,799,572 H276L possibly damaging Het
Klhl6 A T 16: 19,948,127 C506S probably damaging Het
Ldb2 T C 5: 44,541,832 Y88C probably damaging Het
Lrit1 A G 14: 37,055,001 E26G probably benign Het
Mcoln2 A G 3: 146,183,786 Y414C probably damaging Het
Mfsd5 A G 15: 102,280,493 D100G probably damaging Het
Micall2 T A 5: 139,716,469 S340C probably damaging Het
Npsr1 T C 9: 24,300,419 I81T probably damaging Het
Olfr1344 G T 7: 6,440,170 R90L probably benign Het
Olfr331 A G 11: 58,501,605 V317A probably benign Het
Olfr986 T A 9: 40,187,709 L198H possibly damaging Het
Pax3 T C 1: 78,103,418 T444A probably benign Het
Pea15a A G 1: 172,199,242 probably null Het
Phc1 T A 6: 122,334,092 Q95L possibly damaging Het
Plch2 T C 4: 155,000,137 Y361C probably damaging Het
Rad54l2 C T 9: 106,705,858 G787D probably damaging Het
Rbm20 G T 19: 53,834,705 E578* probably null Het
Sipa1l2 A T 8: 125,491,595 D334E probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thumpd1 A G 7: 119,720,720 S8P probably benign Het
Tnxb T C 17: 34,689,593 Y1407H probably damaging Het
Trav2 T A 14: 52,567,833 V37E probably damaging Het
Trav3-1 G T 14: 52,581,037 W56L probably damaging Het
Usp31 A T 7: 121,651,526 L808Q probably damaging Het
Vmn1r52 C T 6: 90,178,912 A66V probably benign Het
Vmn2r105 T A 17: 20,234,782 I31L probably benign Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zbtb2 G T 10: 4,369,275 F250L probably benign Het
Other mutations in Olfr923
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Olfr923 APN 9 38828599 missense possibly damaging 0.93
IGL01521:Olfr923 APN 9 38827889 missense probably damaging 1.00
IGL01548:Olfr923 APN 9 38828350 missense probably benign 0.00
IGL02240:Olfr923 APN 9 38828306 missense probably benign 0.12
IGL02794:Olfr923 APN 9 38828215 missense probably damaging 1.00
R0116:Olfr923 UTSW 9 38828564 missense probably damaging 0.99
R0118:Olfr923 UTSW 9 38827858 missense possibly damaging 0.62
R0189:Olfr923 UTSW 9 38827815 nonsense probably null
R1381:Olfr923 UTSW 9 38828338 missense probably benign 0.04
R1512:Olfr923 UTSW 9 38828364 nonsense probably null
R1702:Olfr923 UTSW 9 38828543 missense probably damaging 1.00
R2357:Olfr923 UTSW 9 38828338 missense probably benign 0.00
R2863:Olfr923 UTSW 9 38828539 missense possibly damaging 0.89
R2985:Olfr923 UTSW 9 38828110 missense probably benign 0.05
R5682:Olfr923 UTSW 9 38828128 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCTTCTGTGATGCCAACC -3'
(R):5'- GTTGTGAATAAAGCAAATCTGGCTC -3'

Sequencing Primer
(F):5'- GTGATGCCAACCTTGTCAATC -3'
(R):5'- GCAAATCTGGCTCTAAATTAATGGAG -3'
Posted On2016-10-06