Mutagenetix > Incidental Mutation

Incidental Mutation 'R5476:Arhgap21'

434063

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

043037-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.442) question?

Stock #

R5476 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20852730-20973692 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20885497 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 560 (N560S)

Ref Sequence

ENSEMBL: ENSMUSP00000133851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114594
AA Change: N564S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: N564S

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141298
AA Change: N570S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: N570S

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154230
AA Change: N570S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: N570S

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173194
AA Change: N560S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: N560S

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174584
AA Change: N399S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: N399S

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Coding Region Coverage

1x: 98.4%
3x: 97.4%
10x: 95.5%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh16a1	T	G	7: 44,791,493 (GRCm39)	N71H	possibly damaging	Het
Alg5	T	A	3: 54,654,019 (GRCm39)	S252T	probably benign	Het
Ccdc96	A	G	5: 36,642,981 (GRCm39)	D329G	possibly damaging	Het
Cep128	T	C	12: 91,180,392 (GRCm39)	E917G	probably damaging	Het
Cpox	G	C	16: 58,499,088 (GRCm39)	V434L	probably damaging	Het
D5Ertd579e	G	T	5: 36,772,601 (GRCm39)	S598Y	probably damaging	Het
Ddx6	A	G	9: 44,518,753 (GRCm39)	R22G	possibly damaging	Het
Dgcr8	A	T	16: 18,077,843 (GRCm39)	Y597N	probably damaging	Het
Dnah2	C	T	11: 69,349,746 (GRCm39)	R2399Q	probably benign	Het
Dock5	T	C	14: 68,051,456 (GRCm39)	D671G	possibly damaging	Het
Dock6	A	G	9: 21,720,885 (GRCm39)	S1707P	probably damaging	Het
Dop1b	A	G	16: 93,570,801 (GRCm39)		probably null	Het
Faim	A	G	9: 98,874,782 (GRCm39)	R110G	probably damaging	Het
Grm4	A	G	17: 27,653,772 (GRCm39)	V726A	probably benign	Het
Hps1	T	C	19: 42,758,041 (GRCm39)		probably null	Het
Lefty1	T	C	1: 180,765,263 (GRCm39)	M277T	probably benign	Het
Mmp9	A	G	2: 164,794,414 (GRCm39)	M469V	probably benign	Het
Mroh4	A	T	15: 74,483,510 (GRCm39)	I609N	probably benign	Het
Myl6b	C	T	10: 128,333,216 (GRCm39)		probably benign	Het
Nt5m	A	G	11: 59,766,733 (GRCm39)	D208G	probably damaging	Het
Pard3b	G	T	1: 62,049,565 (GRCm39)	V108L	probably benign	Het
Pbp2	A	G	6: 135,286,922 (GRCm39)	S142P	probably benign	Het
Pbrm1	T	A	14: 30,754,476 (GRCm39)	D165E	probably benign	Het
Pde4b	A	G	4: 102,459,896 (GRCm39)	K577R	probably benign	Het
Phf21b	A	G	15: 84,671,466 (GRCm39)	M476T	probably benign	Het
Prr14l	T	C	5: 33,001,482 (GRCm39)		probably benign	Het
Ralgapa2	A	G	2: 146,289,356 (GRCm39)	V282A	probably benign	Het
Rif1	A	G	2: 51,979,607 (GRCm39)	I430V	probably damaging	Het
Slc25a12	A	G	2: 71,105,666 (GRCm39)	S623P	probably benign	Het
Smc1b	A	T	15: 84,970,352 (GRCm39)	I967N	probably damaging	Het
Snx13	A	G	12: 35,156,819 (GRCm39)		probably null	Het
Spata2	A	T	2: 167,326,079 (GRCm39)	S247T	probably damaging	Het
Stpg2	T	A	3: 138,948,899 (GRCm39)	Y232N	probably benign	Het
Tor3a	G	T	1: 156,501,137 (GRCm39)	S100R	possibly damaging	Het
Trappc8	A	G	18: 20,998,165 (GRCm39)	F385S	probably damaging	Het
Uggt2	T	A	14: 119,328,121 (GRCm39)	T134S	probably benign	Het
Vmn1r175	C	T	7: 23,508,556 (GRCm39)	V24I	possibly damaging	Het
Wdr1	C	T	5: 38,686,931 (GRCm39)	G278S	probably damaging	Het
Zfp157	T	G	5: 138,455,443 (GRCm39)	V547G	possibly damaging	Het
Zfp442	A	T	2: 150,250,079 (GRCm39)	C551S	probably damaging	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20,860,511 (GRCm39)	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20,854,392 (GRCm39)	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20,919,455 (GRCm39)	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20,854,448 (GRCm39)	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20,884,813 (GRCm39)	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20,885,117 (GRCm39)	missense	probably benign
IGL02264:Arhgap21	APN	2	20,864,850 (GRCm39)	splice site	probably null
IGL02346:Arhgap21	APN	2	20,884,762 (GRCm39)	splice site	probably benign
IGL02418:Arhgap21	APN	2	20,885,711 (GRCm39)	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20,860,399 (GRCm39)	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20,896,902 (GRCm39)	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20,865,874 (GRCm39)	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20,919,532 (GRCm39)	missense	probably benign
IGL03265:Arhgap21	APN	2	20,854,439 (GRCm39)	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20,885,500 (GRCm39)	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20,864,612 (GRCm39)	splice site	probably benign
R0363:Arhgap21	UTSW	2	20,885,944 (GRCm39)	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20,867,928 (GRCm39)	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20,919,610 (GRCm39)	nonsense	probably null
R0633:Arhgap21	UTSW	2	20,860,198 (GRCm39)	nonsense	probably null
R0905:Arhgap21	UTSW	2	20,854,745 (GRCm39)	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20,886,576 (GRCm39)	nonsense	probably null
R1570:Arhgap21	UTSW	2	20,885,651 (GRCm39)	missense	probably benign
R1686:Arhgap21	UTSW	2	20,886,659 (GRCm39)	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20,865,910 (GRCm39)	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20,866,015 (GRCm39)	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20,866,015 (GRCm39)	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20,854,331 (GRCm39)	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20,886,451 (GRCm39)	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2336:Arhgap21	UTSW	2	20,884,862 (GRCm39)	missense	probably damaging	1.00
R2516:Arhgap21	UTSW	2	20,859,809 (GRCm39)	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20,855,102 (GRCm39)	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20,864,717 (GRCm39)	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20,896,915 (GRCm39)	missense	probably benign	0.10
R4232:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4233:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4235:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20,972,146 (GRCm39)	missense	probably benign
R4686:Arhgap21	UTSW	2	20,868,033 (GRCm39)	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20,854,967 (GRCm39)	missense	probably benign
R4834:Arhgap21	UTSW	2	20,870,130 (GRCm39)	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20,885,998 (GRCm39)	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20,885,279 (GRCm39)	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20,854,872 (GRCm39)	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20,863,800 (GRCm39)	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20,854,701 (GRCm39)	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20,884,848 (GRCm39)	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20,853,645 (GRCm39)	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20,854,127 (GRCm39)	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20,854,533 (GRCm39)	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20,885,897 (GRCm39)	missense	probably damaging	0.99
R5831:Arhgap21	UTSW	2	20,868,024 (GRCm39)	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20,853,852 (GRCm39)	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20,886,187 (GRCm39)	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20,886,616 (GRCm39)	missense	probably damaging	1.00
R6739:Arhgap21	UTSW	2	20,885,543 (GRCm39)	missense	possibly damaging	0.94
R6817:Arhgap21	UTSW	2	20,885,107 (GRCm39)	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20,853,659 (GRCm39)	missense	probably benign
R6844:Arhgap21	UTSW	2	20,886,116 (GRCm39)	missense	probably benign	0.00
R6870:Arhgap21	UTSW	2	20,885,321 (GRCm39)	missense	probably damaging	1.00
R6891:Arhgap21	UTSW	2	20,855,142 (GRCm39)	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20,853,689 (GRCm39)	missense	possibly damaging	0.65
R7144:Arhgap21	UTSW	2	20,870,198 (GRCm39)	missense	probably benign
R7237:Arhgap21	UTSW	2	20,854,783 (GRCm39)	nonsense	probably null
R7261:Arhgap21	UTSW	2	20,885,177 (GRCm39)	missense	probably benign
R7558:Arhgap21	UTSW	2	20,860,421 (GRCm39)	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20,917,102 (GRCm39)	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20,855,169 (GRCm39)	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20,854,290 (GRCm39)	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20,867,983 (GRCm39)	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20,885,524 (GRCm39)	missense	possibly damaging	0.80
R7965:Arhgap21	UTSW	2	20,854,007 (GRCm39)	missense	probably damaging	1.00
R7986:Arhgap21	UTSW	2	20,867,967 (GRCm39)	missense	probably damaging	1.00
R8028:Arhgap21	UTSW	2	20,885,216 (GRCm39)	missense	probably benign	0.02
R8209:Arhgap21	UTSW	2	20,876,556 (GRCm39)	missense	probably damaging	1.00
R8226:Arhgap21	UTSW	2	20,876,556 (GRCm39)	missense	probably damaging	1.00
R8251:Arhgap21	UTSW	2	20,854,221 (GRCm39)	missense	probably benign
R8486:Arhgap21	UTSW	2	20,865,236 (GRCm39)	missense	probably damaging	1.00
R8487:Arhgap21	UTSW	2	20,886,116 (GRCm39)	missense	probably benign	0.08
R8508:Arhgap21	UTSW	2	20,858,991 (GRCm39)	missense	probably benign	0.17
R8835:Arhgap21	UTSW	2	20,972,144 (GRCm39)	nonsense	probably null
R9140:Arhgap21	UTSW	2	20,886,025 (GRCm39)	missense	probably damaging	1.00
R9190:Arhgap21	UTSW	2	20,858,983 (GRCm39)	missense	probably null	0.04
R9204:Arhgap21	UTSW	2	20,885,816 (GRCm39)	missense	probably damaging	1.00
R9227:Arhgap21	UTSW	2	20,860,469 (GRCm39)	missense	possibly damaging	0.92
R9230:Arhgap21	UTSW	2	20,860,469 (GRCm39)	missense	possibly damaging	0.92
R9308:Arhgap21	UTSW	2	20,854,061 (GRCm39)	missense	probably damaging	0.99
R9374:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9449:Arhgap21	UTSW	2	20,885,464 (GRCm39)	missense	probably benign
R9454:Arhgap21	UTSW	2	20,870,153 (GRCm39)	missense	probably damaging	0.99
R9499:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9544:Arhgap21	UTSW	2	20,858,938 (GRCm39)	missense	possibly damaging	0.73
R9552:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9567:Arhgap21	UTSW	2	20,896,953 (GRCm39)	missense	possibly damaging	0.94
R9588:Arhgap21	UTSW	2	20,858,938 (GRCm39)	missense	possibly damaging	0.73
R9749:Arhgap21	UTSW	2	20,854,026 (GRCm39)	missense	probably benign	0.00
Z1191:Arhgap21	UTSW	2	20,886,283 (GRCm39)	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- GGCTGAAGGACGGTTTTGAC -3'
(R):5'- ACAGCCACTGTCAATTCTGAAAG -3'

Sequencing Primer
(F):5'- GGCACTTTCAGAGAATTACTTCGGAC -3'
(R):5'- GGTATTCACGAAAGACCC -3'

Posted On

2016-10-06