Incidental Mutation 'R5479:Mdga2'
ID434230
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission 043040-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5479 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66655176 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 417 (C417Y)
Ref Sequence ENSEMBL: ENSMUSP00000152613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: C486Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: C486Y

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000178814
AA Change: C476Y
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: C476Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222167
AA Change: C417Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223141
AA Change: C417Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223289
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 G T 19: 55,280,462 C185F probably damaging Het
Adad2 C A 8: 119,614,915 T185N possibly damaging Het
Apbb1 A T 7: 105,565,025 V315E probably damaging Het
Arfrp1 T C 2: 181,364,398 T32A probably damaging Het
B020004C17Rik T C 14: 57,016,542 S41P probably benign Het
Celsr3 T C 9: 108,844,544 probably null Het
Chd8 C T 14: 52,215,195 G1289D probably benign Het
Ctrl A G 8: 105,933,040 F59S probably damaging Het
Cyp4v3 T A 8: 45,310,206 D356V probably benign Het
Dgka T A 10: 128,729,672 probably null Het
Dnah7b T C 1: 46,223,105 Y2043H probably damaging Het
Eya3 A G 4: 132,672,933 T88A possibly damaging Het
Fat1 A G 8: 45,036,875 D3608G possibly damaging Het
Fmo1 T C 1: 162,850,224 T108A probably damaging Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Ftcd A T 10: 76,578,016 M85L probably benign Het
Ggnbp2 T C 11: 84,854,343 S189G probably benign Het
Gm10251 C T 14: 6,675,781 R35H unknown Het
Gnai2 T G 9: 107,635,166 M18L probably benign Het
Gpx5 T C 13: 21,292,635 Y9C probably benign Het
Grik1 C A 16: 87,936,026 A668S probably damaging Het
Hectd4 A T 5: 121,306,948 M83L probably benign Het
Klra9 T C 6: 130,179,112 R227G probably benign Het
Maz A T 7: 127,025,688 V197D possibly damaging Het
Mbd5 T C 2: 49,272,905 V241A probably damaging Het
Mios C T 6: 8,215,314 T170I probably benign Het
Myh13 G A 11: 67,348,822 A733T probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfs1 G A 2: 156,128,502 T297I probably damaging Het
Nrbf2 A G 10: 67,285,091 probably null Het
Nrg1 T C 8: 31,818,377 Y537C probably damaging Het
Olfr1208 T C 2: 88,896,691 D302G probably benign Het
Onecut3 T A 10: 80,514,022 L450Q probably damaging Het
Pard3 G A 8: 127,370,355 R333Q probably damaging Het
Parp4 T C 14: 56,624,095 F962L probably benign Het
Pilra A G 5: 137,836,056 S22P possibly damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Plxna2 G A 1: 194,793,873 D1134N probably benign Het
Pnpla7 T C 2: 25,019,441 V681A possibly damaging Het
Ppfibp1 T A 6: 147,030,150 probably null Het
Ptprz1 C T 6: 23,001,666 L1252F probably benign Het
Sptb T C 12: 76,599,851 E1999G probably benign Het
Stat3 T C 11: 100,889,888 probably benign Het
Usp25 T C 16: 77,107,913 V789A possibly damaging Het
Zfp148 C A 16: 33,497,219 Q712K probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAAATCATAGCTTTGTCACTGC -3'
(R):5'- CTTGCCAAGTAGAAGCTGTTC -3'

Sequencing Primer
(F):5'- ATCATAGCTTTGTCACTGCTATTG -3'
(R):5'- CAAGTAGAAGCTGTTCCCTCTGAG -3'
Posted On2016-10-06