Incidental Mutation 'R5480:S100a3'
ID434250
Institutional Source Beutler Lab
Gene Symbol S100a3
Ensembl Gene ENSMUSG00000001021
Gene NameS100 calcium binding protein A3
SynonymsS100E
MMRRC Submission 043041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5480 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90560578-90602702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90602284 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 79 (L79F)
Ref Sequence ENSEMBL: ENSMUSP00000142747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001046] [ENSMUST00000001047] [ENSMUST00000142476] [ENSMUST00000200290] [ENSMUST00000200508]
Predicted Effect probably benign
Transcript: ENSMUST00000001046
SMART Domains Protein: ENSMUSP00000001046
Gene: ENSMUSG00000001020

DomainStartEndE-ValueType
Pfam:S_100 5 48 2.1e-23 PFAM
Blast:EFh 54 82 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000001047
AA Change: L79F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001047
Gene: ENSMUSG00000001021
AA Change: L79F

DomainStartEndE-ValueType
Pfam:S_100 5 46 4e-19 PFAM
Blast:EFh 54 82 2e-6 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000107330
AA Change: L39F
SMART Domains Protein: ENSMUSP00000102953
Gene: ENSMUSG00000105518
AA Change: L39F

DomainStartEndE-ValueType
Pfam:S_100 5 47 4.3e-23 PFAM
Blast:EFh 54 82 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142476
SMART Domains Protein: ENSMUSP00000143522
Gene: ENSMUSG00000001020

DomainStartEndE-ValueType
Pfam:S_100 5 47 1.9e-20 PFAM
Blast:EFh 54 78 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196635
Predicted Effect probably damaging
Transcript: ENSMUST00000200290
AA Change: L79F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142334
Gene: ENSMUSG00000001021
AA Change: L79F

DomainStartEndE-ValueType
Pfam:S_100 5 48 1.9e-20 PFAM
Blast:EFh 54 82 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000200508
AA Change: L79F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142747
Gene: ENSMUSG00000001021
AA Change: L79F

DomainStartEndE-ValueType
Pfam:S_100 5 48 1.9e-20 PFAM
Blast:EFh 54 82 2e-6 BLAST
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein has the highest content of cysteines of all S100 proteins, has a high affinity for Zinc, and is highly expressed in human hair cuticle. The precise function of this protein is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Btbd10 T A 7: 113,316,707 R392W probably damaging Het
Camkv A G 9: 107,946,875 D216G probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gipr A G 7: 19,160,654 L241P probably damaging Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pigz G T 16: 31,944,621 G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rgs12 C G 5: 34,966,111 Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Sipa1 A G 19: 5,659,630 L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Strc G T 2: 121,364,819 P1661Q probably benign Het
Taf5l A T 8: 124,009,820 V4E possibly damaging Het
Tbc1d15 T C 10: 115,233,218 E82G probably damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 W122L probably damaging Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in S100a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02299:S100a3 APN 3 90602255 missense possibly damaging 0.51
R1587:S100a3 UTSW 3 90602311 missense probably benign 0.30
R7024:S100a3 UTSW 3 90602440 utr 3 prime probably null
Predicted Primers PCR Primer
(F):5'- AATGGGGCAGCCTAACCATC -3'
(R):5'- ACTTGGCAAGTCTAGATTGAAAGGG -3'

Sequencing Primer
(F):5'- AGCCTAACCATCGGAGGG -3'
(R):5'- CACAGAGAGAGTGGGAAGGGTG -3'
Posted On2016-10-06