Incidental Mutation 'R5480:Rgs12'
ID434252
Institutional Source Beutler Lab
Gene Symbol Rgs12
Ensembl Gene ENSMUSG00000029101
Gene Nameregulator of G-protein signaling 12
Synonyms1200016K18Rik, 4632412M04Rik
MMRRC Submission 043041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R5480 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location34949445-35039644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 34966111 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 413 (Q413E)
Ref Sequence ENSEMBL: ENSMUSP00000084970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030984] [ENSMUST00000087684]
Predicted Effect probably benign
Transcript: ENSMUST00000030984
AA Change: Q413E

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030984
Gene: ENSMUSG00000029101
AA Change: Q413E

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
low complexity region 849 865 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 911 928 N/A INTRINSIC
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
GoLoco 1187 1209 9.74e-9 SMART
low complexity region 1259 1280 N/A INTRINSIC
low complexity region 1292 1308 N/A INTRINSIC
low complexity region 1359 1378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087684
AA Change: Q413E

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101
AA Change: Q413E

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128161
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 'regulator of G protein signaling' (RGS) gene family. The encoded protein may function as a guanosine triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Btbd10 T A 7: 113,316,707 R392W probably damaging Het
Camkv A G 9: 107,946,875 D216G probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gipr A G 7: 19,160,654 L241P probably damaging Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pigz G T 16: 31,944,621 G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
S100a3 C T 3: 90,602,284 L79F probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Sipa1 A G 19: 5,659,630 L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Strc G T 2: 121,364,819 P1661Q probably benign Het
Taf5l A T 8: 124,009,820 V4E possibly damaging Het
Tbc1d15 T C 10: 115,233,218 E82G probably damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 W122L probably damaging Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in Rgs12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rgs12 APN 5 34975219 missense probably benign 0.25
IGL02296:Rgs12 APN 5 34966120 missense probably damaging 0.96
IGL02337:Rgs12 APN 5 35020353 missense probably damaging 1.00
IGL02483:Rgs12 APN 5 35030517 missense probably damaging 1.00
IGL02869:Rgs12 APN 5 35025883 missense probably damaging 0.97
IGL02989:Rgs12 APN 5 34965119 missense probably damaging 1.00
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0245:Rgs12 UTSW 5 35030080 missense probably benign 0.01
R0611:Rgs12 UTSW 5 35019460 missense probably damaging 1.00
R0704:Rgs12 UTSW 5 35023122 missense possibly damaging 0.95
R0723:Rgs12 UTSW 5 35024366 unclassified probably benign
R1174:Rgs12 UTSW 5 34966465 missense probably benign 0.00
R1538:Rgs12 UTSW 5 35021167 missense probably damaging 0.98
R1556:Rgs12 UTSW 5 35039282 missense possibly damaging 0.67
R1774:Rgs12 UTSW 5 34966403 missense probably benign 0.34
R1791:Rgs12 UTSW 5 34966112 missense possibly damaging 0.86
R1866:Rgs12 UTSW 5 34965674 missense probably damaging 1.00
R1872:Rgs12 UTSW 5 34965821 missense probably damaging 1.00
R1923:Rgs12 UTSW 5 35032269 missense probably damaging 1.00
R2012:Rgs12 UTSW 5 35030528 missense probably benign 0.00
R2107:Rgs12 UTSW 5 34966735 missense possibly damaging 0.68
R3730:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3731:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3808:Rgs12 UTSW 5 35032354 missense probably damaging 1.00
R3826:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3827:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3829:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3830:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R4392:Rgs12 UTSW 5 35032311 missense probably damaging 1.00
R4617:Rgs12 UTSW 5 35020356 missense probably damaging 1.00
R5132:Rgs12 UTSW 5 34989812 intron probably benign
R5213:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R5296:Rgs12 UTSW 5 35021104 unclassified probably benign
R5510:Rgs12 UTSW 5 34966039 missense probably damaging 1.00
R5708:Rgs12 UTSW 5 34966352 missense probably benign 0.41
R5987:Rgs12 UTSW 5 35020345 missense probably damaging 1.00
R6053:Rgs12 UTSW 5 34965952 missense probably benign 0.01
R6113:Rgs12 UTSW 5 35020323 missense probably damaging 0.99
R6401:Rgs12 UTSW 5 35020332 missense probably damaging 1.00
R6736:Rgs12 UTSW 5 35023092 missense probably damaging 1.00
R6807:Rgs12 UTSW 5 35023171 missense probably null 0.27
R6857:Rgs12 UTSW 5 35030022 nonsense probably null
R7082:Rgs12 UTSW 5 34966706 missense probably benign 0.00
R7250:Rgs12 UTSW 5 34965497 missense probably damaging 1.00
R7276:Rgs12 UTSW 5 35026371 missense probably benign 0.06
R7444:Rgs12 UTSW 5 35025943 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGGTGGACCCAGACTTATTTC -3'
(R):5'- ATTCCAGGGTGCACTCCAAG -3'

Sequencing Primer
(F):5'- GGTGGACCCAGACTTATTTCATCAC -3'
(R):5'- TGCACTCCAAGGCTGTGAG -3'
Posted On2016-10-06