Incidental Mutation 'R5480:Gipr'
ID434256
Institutional Source Beutler Lab
Gene Symbol Gipr
Ensembl Gene ENSMUSG00000030406
Gene Namegastric inhibitory polypeptide receptor
SynonymsLOC232937, glucose-dependent insulinotropic polypeptide receptor, LOC381853
MMRRC Submission 043041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5480 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19156061-19166127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19160654 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 241 (L241P)
Ref Sequence ENSEMBL: ENSMUSP00000092384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094790] [ENSMUST00000206971]
Predicted Effect probably damaging
Transcript: ENSMUST00000094790
AA Change: L241P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092384
Gene: ENSMUSG00000030406
AA Change: L241P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
HormR 53 123 6.14e-23 SMART
Pfam:7tm_2 130 384 1.3e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206857
Predicted Effect probably benign
Transcript: ENSMUST00000206971
Meta Mutation Damage Score 0.416 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor for gastric inhibitory polypeptide (GIP), which was originally identified as an activity in gut extracts that inhibited gastric acid secretion and gastrin release, but subsequently was demonstrated to stimulate insulin release in the presence of elevated glucose. Mice lacking this gene exhibit higher blood glucose levels with impaired initial insulin response after oral glucose load. Defect in this gene thus may contribute to the pathogenesis of diabetes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this gene results in mild glucose intolerance due to impaired glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Btbd10 T A 7: 113,316,707 R392W probably damaging Het
Camkv A G 9: 107,946,875 D216G probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pigz G T 16: 31,944,621 G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rgs12 C G 5: 34,966,111 Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
S100a3 C T 3: 90,602,284 L79F probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Sipa1 A G 19: 5,659,630 L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Strc G T 2: 121,364,819 P1661Q probably benign Het
Taf5l A T 8: 124,009,820 V4E possibly damaging Het
Tbc1d15 T C 10: 115,233,218 E82G probably damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 W122L probably damaging Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in Gipr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Gipr APN 7 19159506 unclassified probably benign
IGL02214:Gipr APN 7 19157546 missense possibly damaging 0.46
IGL02525:Gipr APN 7 19159765 missense possibly damaging 0.64
IGL03163:Gipr APN 7 19162556 nonsense probably null
PIT4449001:Gipr UTSW 7 19160618 missense probably benign 0.05
PIT4480001:Gipr UTSW 7 19162934 missense probably damaging 1.00
R1813:Gipr UTSW 7 19164071 missense probably benign 0.02
R1896:Gipr UTSW 7 19164071 missense probably benign 0.02
R3409:Gipr UTSW 7 19159794 missense possibly damaging 0.74
R3949:Gipr UTSW 7 19157429 missense probably benign 0.00
R4781:Gipr UTSW 7 19157375 missense possibly damaging 0.95
R4841:Gipr UTSW 7 19162676 missense probably damaging 1.00
R4842:Gipr UTSW 7 19162676 missense probably damaging 1.00
R5087:Gipr UTSW 7 19159764 missense probably damaging 1.00
R5297:Gipr UTSW 7 19157544 missense probably damaging 1.00
R5763:Gipr UTSW 7 19163550 missense probably damaging 0.99
R6957:Gipr UTSW 7 19164604 missense probably benign 0.01
R7035:Gipr UTSW 7 19162884 missense probably damaging 1.00
R7254:Gipr UTSW 7 19163613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTTCAGCAAGGGAGTGG -3'
(R):5'- ATGGAGATGAGCCCTGTTTG -3'

Sequencing Primer
(F):5'- CAGCAAGGGAGTGGGAGGG -3'
(R):5'- AAGTCCCATAGTCCCAGTTAGGTG -3'
Posted On2016-10-06