Incidental Mutation 'R5480:Btbd10'
ID434264
Institutional Source Beutler Lab
Gene Symbol Btbd10
Ensembl Gene ENSMUSG00000038187
Gene NameBTB (POZ) domain containing 10
SynonymsGmrp1, 1110056N09Rik
MMRRC Submission 043041-MU
Accession Numbers

Ncbi RefSeq: NM_133700.2; MGI:1916065

Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R5480 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location113315626-113369392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113316707 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 392 (R392W)
Ref Sequence ENSEMBL: ENSMUSP00000113496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047091] [ENSMUST00000047321] [ENSMUST00000117577] [ENSMUST00000119278] [ENSMUST00000135510] [ENSMUST00000210074] [ENSMUST00000210238] [ENSMUST00000211770]
Predicted Effect probably damaging
Transcript: ENSMUST00000047091
AA Change: R384W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048530
Gene: ENSMUSG00000038187
AA Change: R384W

DomainStartEndE-ValueType
low complexity region 60 75 N/A INTRINSIC
low complexity region 106 147 N/A INTRINSIC
BTB 167 272 1.58e-4 SMART
low complexity region 311 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047321
SMART Domains Protein: ENSMUSP00000046235
Gene: ENSMUSG00000055116

DomainStartEndE-ValueType
HLH 78 131 2.92e-16 SMART
PAS 146 213 4.41e-12 SMART
PAS 328 394 1.66e-7 SMART
PAC 401 444 2.92e-3 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117577
AA Change: R392W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113496
Gene: ENSMUSG00000038187
AA Change: R392W

DomainStartEndE-ValueType
low complexity region 68 83 N/A INTRINSIC
low complexity region 114 155 N/A INTRINSIC
BTB 175 280 1.58e-4 SMART
low complexity region 319 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119278
AA Change: R336W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113632
Gene: ENSMUSG00000038187
AA Change: R336W

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 58 99 N/A INTRINSIC
BTB 119 224 1.58e-4 SMART
low complexity region 263 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135510
SMART Domains Protein: ENSMUSP00000114806
Gene: ENSMUSG00000038187

DomainStartEndE-ValueType
low complexity region 60 75 N/A INTRINSIC
low complexity region 106 147 N/A INTRINSIC
SCOP:d1t1da_ 167 198 3e-6 SMART
Blast:BTB 167 200 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000210074
Predicted Effect probably benign
Transcript: ENSMUST00000210238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211547
Predicted Effect probably benign
Transcript: ENSMUST00000211770
Meta Mutation Damage Score 0.592 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
Allele List at MGI

All alleles(12) : Targeted(2) Gene trapped(10)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Camkv A G 9: 107,946,875 D216G probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gipr A G 7: 19,160,654 L241P probably damaging Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pigz G T 16: 31,944,621 G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rgs12 C G 5: 34,966,111 Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
S100a3 C T 3: 90,602,284 L79F probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Sipa1 A G 19: 5,659,630 L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Strc G T 2: 121,364,819 P1661Q probably benign Het
Taf5l A T 8: 124,009,820 V4E possibly damaging Het
Tbc1d15 T C 10: 115,233,218 E82G probably damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 W122L probably damaging Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in Btbd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Btbd10 APN 7 113316556 missense probably damaging 1.00
IGL03223:Btbd10 APN 7 113332670 missense probably damaging 1.00
I1329:Btbd10 UTSW 7 113332875 missense probably benign 0.00
R0022:Btbd10 UTSW 7 113325781 nonsense probably null
R0022:Btbd10 UTSW 7 113325781 nonsense probably null
R0136:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R0299:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R0599:Btbd10 UTSW 7 113335309 splice site probably benign
R0657:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R1401:Btbd10 UTSW 7 113347059 missense probably benign 0.06
R2916:Btbd10 UTSW 7 113332824 missense probably benign
R3429:Btbd10 UTSW 7 113351809 nonsense probably null
R3430:Btbd10 UTSW 7 113351809 nonsense probably null
R4578:Btbd10 UTSW 7 113322752 missense possibly damaging 0.93
R4626:Btbd10 UTSW 7 113328398 missense probably damaging 0.96
R5067:Btbd10 UTSW 7 113325836 missense probably damaging 0.99
R5667:Btbd10 UTSW 7 113332724 missense probably damaging 1.00
R6468:Btbd10 UTSW 7 113347059 missense probably benign 0.06
R6877:Btbd10 UTSW 7 113322760 missense probably damaging 1.00
R6952:Btbd10 UTSW 7 113351943 splice site probably null
R7059:Btbd10 UTSW 7 113329922 missense probably damaging 0.97
X0027:Btbd10 UTSW 7 113316698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGACTACTAGCTGGTCCTG -3'
(R):5'- CTGCTGGTACTCGGATAAAGC -3'

Sequencing Primer
(F):5'- TCCTGGGGAATGTCTGCAGC -3'
(R):5'- CTGGTACTCGGATAAAGCCTAGAC -3'
Posted On2016-10-06